Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU053361

Sigma-Aldrich

MISSION® esiRNA

targeting human ADORA2B

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Check Cart for Availability
Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Check Cart for Availability

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

AATGAAAGCTGCTGCCTTGTGAAGTGTCTCTTTGAGAATGTGGTCCCCATGAGCTACATGGTATATTTCAATTTCTTTGGGTGTGTTCTGCCCCCACTGCTTATAATGCTGGTGATCTACATTAAGATCTTCCTGGTGGCCTGCAGGCAGCTTCAGCGCACTGAGCTGATGGACCACTCGAGGACCACCCTCCAGCGGGAGATCCATGCAGCCAAGTCACTGGCCATGATTGTGGGGATTTTTGCCCTGTGCTGGTTACCTGTGCATGCTGTTAACTGTGTCACTCTTTTCCAGCCAGCTCAGGGTAAAAATAAGCCCAAGTGGGCAATGAATATGGCCATTCTTCTGTCACATGCCAATTCAGTTGTCAATCCCATTGTCTATGCTTACCGGAACCGAG

Ensembl | Número de adesão de ser humano

ENSG00000170425

nº de adesão NCBI

NM_000676

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ADORA2B(136) , ADORA2B(136)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
JXU
QCS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Alisha Wehdnesday Bernardo Reyes et al.
Veterinary microbiology, 242, 108586-108586 (2020-03-04)
Brucella as a stealthy intracellular pathogen avoids activation of innate immune response. Here we investigated the contribution of an adenosine receptor, Adora2b, during Brucella infection in professional phagocyte RAW 264.7 cells and in a murine model. Adora2b-deficient cells showed attenuated
Max Wilkat et al.
International journal of cancer, 147(1), 202-217 (2019-12-18)
Adenosine is a signaling molecule that exerts dual effects on tumor growth: while it inhibits immune cell function and thereby prevents surveillance by the immune system, it influences tumorigenesis directly via activation of adenosine receptors on tumor cells at the
J S Long et al.
Oncogene, 34(40), 5152-5162 (2015-02-11)
Tumour cells often acquire the ability to escape cell death, a key event leading to the development of cancer. In almost half of all human cancers, the capability to induce cell death is reduced by the mutation and inactivation of

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica