Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU051511

Sigma-Aldrich

MISSION® esiRNA

targeting human LNPK

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TTTGAGAAGAGGCAGGTGGTGGAAGGTTCAAGTTCAGTTGGTCCCTTGCCATCAGGAAGTGTGCTTTCATCAGACAACCAGTTTAATGAAGAATCTTTAGAACACGATGTTCTTGATGATAATACAGAGCAGACAGATGACAAAATACCAGCTACAGAACAGACAAACCAAGTGATTGAAAAAGCATCTGACTCAGAGGAACCAGAGGAGAAACAAGAGACTGAGAATGAGGAAGCCTCAGTGATTGAAACCAACTCCACAGTTCCTGGAGCTGATTCTATTCCTGATCCTGAACTAAGTGGAGAATCTTTGACGGCAGAGTAGTAAATGCTTCCACGTGCCTTCAACTGGATATTTATAGTCTTACTGATGTCAGTTATTGCTTTTTCGGTGGCACTTAC

Ensembl | Número de adesão de ser humano

ENSG00000144320

nº de adesão NCBI

NM_030650

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... LNPK(80856) , KIAA1715(80856)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
QCS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jian-Bin Qiao et al.
Journal of controlled release : official journal of the Controlled Release Society, 321, 629-640 (2020-03-07)
Liver fibrosis leads to over one million deaths annually worldwide. Hepatic stellate cells (HSCs) have been identified as the main executors of liver fibrosis. Unfortunately, no drug has yet been approved for clinical use against liver fibrosis, largely because the
Genc Basha et al.
Molecular therapy. Nucleic acids, 5(9), e363-e363 (2016-09-14)
Sclerostin is a protein secreted by osteocytes that is encoded by the SOST gene; it decreases bone formation by reducing osteoblast differentiation through inhibition of the Wnt signaling pathway. Silencing the SOST gene using RNA interference (RNAi) could therefore be
Kaishun Zhao et al.
Aging, 12(10), 9125-9138 (2020-05-29)
Inflammation is an important cause of chronic obstructive pulmonary disease (COPD) and its acute exacerbation. However, the critical role of C-C chemokine receptor (CCR)1 in progression of cigarette smoke-induced chronic inflammation remains unclear. We studied CCR1 expression using immunohistochemistry, immunofluorescence
Kasra Khalaj et al.
Scientific reports, 7(1), 5883-5883 (2017-07-21)
Endometriosis, a major reproductive pathology affecting 8-10% of women is characterized by chronic inflammation and immune dysfunction. Human antigen R (HuR) and Tristetraprolin (TTP) are RNA binding proteins that competitively bind to cytokines involved in inflammation including: tumor necrosis factor
Ayaka Okamoto et al.
Biochemical and biophysical research communications, 449(4), 460-465 (2014-05-24)
An Fab' antibody against heparin-binding epidermal growth factor-like growth factor (HB-EGF) was applied to achieve advanced tumor-targeted delivery of siRNA. Lipid nanoparticles (LNP) encapsulating siRNA (LNP-siRNA) were prepared, pegylated, and surface modified with Fab' fragments of anti-HB-EGF antibody (αHB-EGF LNP-siRNA).

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica