Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU051271

Sigma-Aldrich

MISSION® esiRNA

targeting human PDGFRB

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGTGACACTGCACGAGAAGAAAGGGGACGTTGCACTGCCTGTCCCCTATGATCACCAACGTGGCTTTTCTGGTATCTTTGAGGACAGAAGCTACATCTGCAAAACCACCATTGGGGACAGGGAGGTGGATTCTGATGCCTACTATGTCTACAGACTCCAGGTGTCATCCATCAACGTCTCTGTGAACGCAGTGCAGACTGTGGTCCGCCAGGGTGAGAACATCACCCTCATGTGCATTGTGATCGGGAATGAGGTGGTCAACTTCGAGTGGACATACCCCCGCAAAGAAAGTGGGCGGCTGGTGGAGCCGGTGACTGACTTCCTCTTGGATATGCCTTACCACATCCGCTCCATCCTGCACATCCCCAGTGCCGAGTTAGAAGACTCGGGGACCTACACCT

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Bhanupriya Madarampalli et al.
Biochimica et biophysica acta. Molecular basis of disease, 1865(6), 1516-1524 (2019-03-17)
Cadherins are homophilic cell-to-cell adhesion molecules that help cells respond to environmental changes. Newly formed cadherin junctions are associated with increased cell phosphorylation, but the pathways driving this signaling response are largely unknown. Since cadherins have no intrinsic signaling activity
Zachary K Goldsmith et al.
Investigative ophthalmology & visual science, 59(11), 4486-4495 (2018-09-08)
Vitreous seeding remains the primary reason for treatment failure in eyes with retinoblastoma (Rb). Systemic and intra-arterial chemotherapy, each with its own inherent set of complications, have improved salvage rates for eyes with advanced disease, but the location and biology
N Shioda et al.
Molecular psychiatry, 22(8), 1205-1222 (2016-12-07)
Aberrant dopamine D
Yaoping Liu et al.
Genome research, 25(5), 679-689 (2015-04-11)
Candida albicans, the major invasive fungal pathogen of humans, can cause both debilitating mucosal infections and fatal invasive infections. Understanding the complex nature of the host-pathogen interaction in each of these contexts is essential to developing desperately needed therapies to
Fengfei Wang et al.
Oncotarget, 6(5), 2709-2724 (2015-01-13)
Over-expression of PDGF receptors (PDGFRs) has been previously implicated in high-risk medulloblastoma (MB) pathogenesis. However, the exact biological functions of PDGFRα and PDGFRβ signaling in MB biology remain poorly understood. Here, we report the subgroup specific expression of PDGFRα and

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica