Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU050781

Sigma-Aldrich

MISSION® esiRNA

targeting human LIN28B

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GCCCCTTGGATATTCCAGTCGATGTATTTGTACACCAAAGCAAACTATTCATGGAAGGATTTAGAAGCCTAAAAGAAGGAGAACCAGTGGAATTCACATTTAAAAAATCTTCCAAAGGCCTTGAGTCAATACGGGTAACAGGACCTGGTGGGAGCCCCTGTTTAGGAAGTGAAAGAAGACCCAAAGGGAAGACACTACAGAAAAGAAAACCAAAGGGAGATAGATGCTACAACTGTGGTGGCCTTGATCATCATGCTAAGGAATGTAGTCTACCTCCTCAGCCAAAGAAGTGCCATTACTGTCAGAGCATCATGCACATGGTGGCAAACTGCCCACATAAAAATGTTGCACAGCCACCCGCGAGTTCTCAGGGAAGACAGGAAGCAGAATCCCAGCCATGCACTTCAACTCTCCCTCGAGAAGTGGGAGGCGGGCATGGCTGTACATCACCAC

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jianbiao Zhou et al.
Journal of hematology & oncology, 10(1), 138-138 (2017-07-12)
Current conventional chemotherapy for acute myeloid leukemia (AML) can achieve remission in over 70% of patients, but a majority of them will relapse within 5 years despite continued treatment. The relapse is postulated to be due to leukemia stem cells (LSCs)
Jing Wu et al.
Acta biochimica et biophysica Sinica, 51(5), 455-462 (2019-04-09)
Choriocarcinoma is a rare and malignant trophoblastic tumor. However, the molecular mechanisms by which choriocarcinoma is regulated remain unknown. In the present study, we first elucidated that LIN28B was highly expressed in human choriocarcinoma tissues and choriocarcinoma cell lines. Our
Chong Chen et al.
Cancer research, 75(8), 1725-1735 (2015-03-07)
Considerable evidence suggests that proinflammatory pathways drive self-renewal of cancer stem-like cells (CSC), but the underlying mechanisms remain mainly undefined. Here we report that the let7 repressor LIN28B and its regulator IKBKB (IKKβ) sustain cancer cell stemness by interacting with
B-X Yan et al.
Oncogene, 33(45), 5288-5294 (2013-11-05)
Tumor drug resistance remains a major challenge in the treatment of cancer. Here, we show that Prostatic secretory protein 94 (PSP94) levels are reduced in ovarian cancer patients with high levels of excision repair cross-complementing 1 (ERCC1), a marker for

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica