Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU049751

Sigma-Aldrich

MISSION® esiRNA

targeting human FEM1B

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

AGCTGATAAAATGGCGTGCTGCTATAGTAGTGAATGGCCATGGGATGACGCCATTGAAAGTAGCTGCCGAAAGCTGTAAAGCTGATGTCGTAGAACTGTTACTCTCTCATGCTGATTGCGACCGAAGAAGTCGGATTGAAGCTTTGGAACTCTTGGGTGCCTCCTTTGCAAATGACCGTGAGAACTATGACATCATAAAGACATACCACTATCTATATTTAGCCATGTTAGAGAGGTTCCAAGATGGTGATAACATTCTCGAAAAAGAGGTTCTTCCACCAATCCATGCTTATGGGAATAGAACTGAATGTAGAAATCCTCAGGAACTGGAGTCCATTCGGCAAGACAGAGATGCTCTTCATATGGAAGGCCTTATAGTTCGGGAACGGATTTTAGGTGCTGACAATATTGATGTTTCTCATCCCATCATTTACAGAGGAGCTGTTTATGCGGA

Ensembl | Número de adesão de ser humano

ENSG00000169018

nº de adesão NCBI

NM_015322

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... FEM1B(10116) , FEM1B(10116)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

John F Dankert et al.
Cell cycle (Georgetown, Tex.), 16(6), 556-564 (2017-01-25)
FEM1A, FEM1B, and FEM1C are evolutionarily-conserved VHL-box proteins, the substrate recognition subunits of CUL2-RING E3 ubiquitin ligase complexes. Here, we report that FEM1 proteins are ancient regulators of Stem-Loop Binding Protein (SLBP), a conserved protein that interacts with the stem
Keiichi Tamai et al.
Scientific reports, 10(1), 21592-21592 (2020-12-11)
Cancer stem cells (CSCs) define a subpopulation of cancer cells that are resistant to therapy. However, little is known of how CSC characteristics are regulated. We previously showed that dormant cancer stem cells are enriched with a CD274low fraction of

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica