Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU049441

Sigma-Aldrich

MISSION® esiRNA

targeting human MSH6

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CAGTGAACTGGGGCTGGTATTCATGAAAGGCAACTGGGCCCATTCTGGCTTTCCTGAAATTGCATTTGGCCGTTATTCAGATTCCCTGGTGCAGAAGGGCTATAAAGTAGCACGAGTGGAACAGACTGAGACTCCAGAAATGATGGAGGCACGATGTAGAAAGATGGCACATATATCCAAGTATGATAGAGTGGTGAGGAGGGAGATCTGTAGGATCATTACCAAGGGTACACAGACTTACAGTGTGCTGGAAGGTGATCCCTCTGAGAACTACAGTAAGTATCTTCTTAGCCTCAAAGAAAAAGAGGAAGATTCTTCTGGCCATACTCGTGCATATGGTGTGTGCTTTGTTGATACTTCACTGGGAAAGTTTTTCATAGGTCAGTTTTCAGATGATCGCCA

Ensembl | Número de adesão de ser humano

ENSG00000116062

nº de adesão NCBI

NM_000179

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... MSH6(2956) , MSH6(2956)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Fumi Higuchi et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 26(7), 1690-1699 (2020-01-05)
Emergence of mismatch repair (MMR) deficiency is a frequent mechanism of acquired resistance to the alkylating chemotherapeutic temozolomide (TMZ) in gliomas. Poly(ADP-ribose) polymerase inhibitors (PARPi) have been shown to potentiate TMZ cytotoxicity in several cancer types, including gliomas. We tested
Daniel J McGrail et al.
Cancer cell, 37(3), 371-386 (2020-02-29)
Deficient DNA mismatch repair (dMMR) induces a hypermutator phenotype that can lead to tumorigenesis; however, the functional impact of the high mutation burden resulting from this phenotype remains poorly explored. Here, we demonstrate that dMMR-induced destabilizing mutations lead to proteome
Sarah J Young et al.
Cell reports, 33(3), 108289-108289 (2020-10-22)
MutSα and MutSβ play important roles in DNA mismatch repair and are linked to inheritable cancers and degenerative disorders. Here, we show that MSH2 and MSH3, the two components of MutSβ, bind SLX4 protein, a scaffold for the assembly of

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica