Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU049401

Sigma-Aldrich

MISSION® esiRNA

targeting human UCHL5

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CAACTTGCAGAGGAGGAACCCATGGATACAGATCAAGGTAATAGTATGTTAAGTGCTATTCAGTCAGAAGTTGCCAAAAATCAGATGCTTATTGAAGAAGAAGTACAGAAATTAAAAAGATACAAGATTGAGAATATCAGAAGGAAGCATAATTATCTGCCTTTCATTATGGAATTGTTAAAGACTTTAGCAGAACACCAGCAGTTAATACCACTAGTAGAAAAGGCAAAAGAAAAACAGAACGCAAAGAAAGCTCAGGAAACCAAATGAAGATGTTTTCAGATATGTACACATTTCTGCTTCTGCACATATTTTCATGGAAACCATTATGTATAAAGAACTTAGAGCAACATCCTAATTGGCTCAGTGCACGTTTGGCAATAGTGCCAGCCTGTCTTGTCT

Ensembl | Número de adesão de ser humano

ENSG00000116750

nº de adesão NCBI

NM_015984

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... UCHL5(51377) , UCHL5(51377)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
XZU
OWU
QCS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Wonhee Han et al.
Scientific reports, 7, 42590-42590 (2017-02-16)
The Tcf/Lef family of transcription factors mediates the Wnt/β-catenin pathway that is involved in a wide range of biological processes, including vertebrate embryogenesis and diverse pathogenesis. Post-translational modifications, including phosphorylation, sumoylation and acetylation, are known to be important for the
Jieru Zhang et al.
Journal of Cancer, 11(22), 6675-6685 (2020-10-14)
Lung cancer is one of the most common malignant tumors in the world, with a high rate of malignancy and mortality. Seeking new biomarkers and potential drug targets is urgent for effective treatment of the disease. Deubiquitinase UCHL5/UCH37, as an
Susu Guo et al.
Cell death & disease, 12(1), 42-42 (2021-01-09)
The regulation of homeostasis in the Ubiquitin (Ub) proteasome system (UPS) is likely to be important for the development of liver cancer. Tribbles homolog 2 (TRIB2) is known to affect Ub E3 ligases (E3s) in liver cancer. However, whether TRIB2
Evangel Kummari et al.
PloS one, 10(8), e0135531-e0135531 (2015-08-13)
Although protein ubiquitination has been shown to regulate multiple processes during host response to Salmonella enterica serovar Typhimurium infection, specific functions of host deubiquitinating enzymes remain unknown in this bacterial infection. By using chemical proteomics approach, in which deubiquitinating enzymes

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica