Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU049181

Sigma-Aldrich

MISSION® esiRNA

targeting human ZHX1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TCAAACCAGACCGTGAAGAAATTGTAGAAAATCCAAGTTCTTCAGCTTCTGAATCTAATACAAGTACTTCCATTGTAAACAGAATACATCCAAGTACTGCCAGCACGGTAGTGACACCAGCAGCAGTTCTTCCTGGATTGGCACAGGTGATAACTGCTGTATCTGCTCAGCAGAATTCTAATTTGATTCCCAAAGTCTTAATCCCTGTTAATAGCATTCCCACCTACAATGCTGCATTGGATAACAATCCCCTTTTACTTAACACCTACAACAAGTTCCCTTACCCAACAATGTCAGAAATTACAGTTCTTTCTGCTCAAGCAAAATATACAGAGGAACAGATCAAGATATGGTTTTCAGCCCAACGTTTAAAACATGGTGTTAGTTGGACTCCCGAGGAAGT

Ensembl | Número de adesão de ser humano

ENSG00000165156

nº de adesão NCBI

NM_007222

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ZHX1(11244) , ZHX1(11244)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
KFS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ryuk-Jun Kwon et al.
PloS one, 11(11), e0165516-e0165516 (2016-11-12)
Zinc-fingers and homeoboxes 1 (ZHX1) is a transcription repressor that has been associated with the progressions of hepatocellular carcinoma, gastric cancer, and breast cancer. However, the functional roles of ZHX1 in cholangiocarcinoma (CCA) have not been determined. We investigated the
Yi-Kai Pan et al.
Apoptosis : an international journal on programmed cell death, 25(1-2), 73-91 (2019-11-27)
Weightlessness-induced cardiovascular dysfunction can lead to physiological and pathological consequences. It has been shown that spaceflight or simulated microgravity can alter expression profiles of some microRNAs (miRNAs). Here, we attempt to identify the role of miRNAs in human umbilical vein
Jinping Guan et al.
American journal of translational research, 9(5), 2457-2465 (2017-06-01)
MicroRNAs play an important role in cell proliferation, apoptosis, differentiation, and invasion by regulating the expression of various genes. For example, the downregulation of microRNA-199a-3p (miR-199a-3p) that is noted in numerous human malignancies, including hepatocellular carcinoma (HCC), results in a

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica