Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU046951

Sigma-Aldrich

MISSION® esiRNA

targeting human ARG2, VTI1B

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CTCAGAGGAAGAGGCGAAGACTACAGCTAACCTGGCAGTAGATGTGATTGCTTCAAGCTTTGGTCAGACAAGAGAAGGAGGGCATATTGTCTATGACCAACTTCCTACTCCCAGTTCACCAGATGAATCAGAAAATCAAGCACGTGTGAGAATTTAGGAGACACTGTGCACTGACATGTTTCACAACAGGCATTCCAGAATTATGAGGCATTGAGGGGATAGATGAATACTAAATGGTTGTCTGGGTCAATACTGCCTTAATGAGAACATTTACACATTCTCACAATTGTAAAGTTTCCCCTCTATTTTGGTGACCAATACTACTGTAAATGTATTTGGTTTTTTGCAGTTCACAGGGTATTAATATGCTACAGTACTATGTAAATTTAAAGAAGTCATAAACAGCATTTATTACCTTGGTATATCATACTGGTCTTGTTGCTGTTGTTCCTTCACA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Bon-Hyeock Koo et al.
Cells, 9(2) (2020-02-13)
Arginase II reciprocally regulates endothelial nitric oxide synthase (eNOS) through a p32-dependent Ca2+ control. We investigated the signaling pathway of arginase II-dependent eNOS phosphorylation. Western blot analysis was applied for examining protein activation and [Ca2+]c was analyzed by microscopic and
Bon-Hyeock Koo et al.
Experimental & molecular medicine, 51(6), 60-60 (2019-06-04)
Although arginase II (ArgII) is abundant in mitochondria, Ca2+-accumulating organelles, the relationship between ArgII activity and Ca2+ translocation into mitochondria and the regulation of cytosolic Ca2+ signaling are completely unknown. We investigated the effects of ArgII activity on mitochondrial Ca2+
Kwanhoon Choi et al.
Molecular medicine reports, 22(3), 2395-2403 (2020-07-25)
The p32 protein plays a crucial role in the regulation of cytosolic Ca2+ concentrations ([Ca2+]c) that contributes to the Ca2+‑dependent signaling cascade. Using an adenovirus and plasmid p32‑overexpression system, the aim of the study was to evaluate the role of p32

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica