Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU046811

Sigma-Aldrich

MISSION® esiRNA

targeting human S100A10

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

AAATTCGCTGGGGATAAAGGCTACTTAACAAAGGAGGACCTGAGAGTACTCATGGAAAAGGAGTTCCCTGGATTTTTGGAAAATCAAAAAGACCCTCTGGCTGTGGACAAAATAATGAAGGACCTGGACCAGTGTAGAGATGGCAAAGTGGGCTTCCAGAGCTTCTTTTCCCTAATTGCGGGCCTCACCATTGCATGCAATGACTATTTTGTAGTACACATGAAGCAGAAGGGAAAGAAGTAGGCAGAAATGAGCAGTTCGCTCCTCCCTGATAAGAGTTGTCCCAAAGGGTCGCTTAAGGAATCTGCCCCACAGCTTCCCCCATAGAAGGATTTCATGAGCAGATCAGGACACTTAGCAAATGTAAAAATAAAATCTAACTCTCATTTGACAAGCAGAGAAAGAAAAGTTAAATACCAGATAAGCTTTTGATTTTTGTATTGTTTGCATCCCCTTGC

Ensembl | Número de adesão de ser humano

ENSG00000197747

nº de adesão NCBI

NM_002966

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... S100A10(6281) , S100A10(6281)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yan Li et al.
Frontiers in cell and developmental biology, 8, 559486-559486 (2020-12-17)
S100 calcium-binding protein A10 (S100A10) is crucially involved in the tumorigenesis of multiple malignant tumors. Reprogrammed glucose metabolism is emerging as a hallmark of various human cancers. However, the function of S100A10 in aerobic glycolysis is unclear. The expression of
Moamen Bydoun et al.
Scientific reports, 8(1), 14091-14091 (2018-09-22)
Cancer dissemination is initiated by the movement of cells into the vasculature which has been reported to be triggered by EMT (epithelial to mesenchymal transition). Cellular dissemination also requires proteases that remodel the extracellular matrix. The protease, plasmin is a
K-W Lee et al.
Molecular psychiatry, 20(12), 1546-1556 (2015-09-16)
Mood disorders and antidepressant therapy involve alterations of monoaminergic and glutamatergic transmission. The protein S100A10 (p11) was identified as a regulator of serotonin receptors, and it has been implicated in the etiology of depression and in mediating the antidepressant actions

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica