Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU045911

Sigma-Aldrich

MISSION® esiRNA

targeting human MGP

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ACTGACCTGCAGGACGAAACCATGAAGAGCCTGATCCTTCTTGCCATCCTGGCCGCCTTAGCGGTAGTAACTTTGTGTTATGAATCACATGAAAGCATGGAATCTTATGAACTTAATCCCTTCATTAACAGGAGAAATGCAAATACCTTCATATCCCCTCAGCAGAGATGGAGAGCTAAAGTCCAAGAGAGGATCCGAGAACGCTCTAAGCCTGTCCACGAGCTCAATAGGGAAGCCTGTGATGACTACAGACTTTGCGAACGCTACGCCATGGTTTATGGATACAATGCTGCCTATAATCGCTACTTCAGGAAGCGCCGAGGGACCAAATGAGACTGAGGGAAGAAAAAAAATCTCTTTTTTTCTGGAGGCTGGCACCTGATTTTGTATCCCCCTGTAGCAGC

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Mizhu Wang et al.
Molecular oncology, 14(5), 1045-1058 (2020-02-23)
Matrix Gla protein (MGP) has been widely reported as an extracellular matrix protein with abnormal expression in various types of cancer. However, the function of intracellular MGP in gastric cancer (GC) cells remains largely unknown. Here, we demonstrated aberrantly high
Changgeng Fu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 51(4), 1739-1750 (2018-12-07)
Radix notoginseng is a well-known traditional Chinese herbal medicine, has extensively pharmacological activities in cardiovascular system. Notoginsenoside R1 (NGR1) is one main active ingredient of Radix notoginseng. The purpose of this study was to evaluate the functional effects of NGR1
Xueqing Li et al.
Molecular therapy oncolytics, 17, 371-383 (2020-05-15)
Matrix Gla protein (MGP), an extracellular matrix protein, is mainly associated with the inhibition of calcification in skeleton, coronary artery, and kidney, and more recently it has also been implicated in cancer. However, the biological function of MGP inside cancer

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica