Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU045551

Sigma-Aldrich

MISSION® esiRNA

targeting human STK39

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CCCACCCAATGCTAATGAAGACTACAGAGAAGCTTCTTCTTGTGCCGTGAACCTCGTTTTGAGATTAAGAAACTCCAGAAAGGAACTTAATGACATACGATTTGAGTTTACTCCAGGAAGAGATACAGCAGATGGTGTATCTCAGGAGCTCTTCTCTGCTGGCTTGGTGGATGGTCACGATGTAGTTATAGTGGCTGCTAATTTACAGAAGATTGTAGATGATCCCAAAGCTTTAAAAACATTGACATTTAAGTTGGCTTCTGGCTGTGATGGGTCGGAGATTCCTGATGAAGTGAAGCTGATTGGGTTTGCTCAGTTGAGTGTCAGCTGATGTATGTCCCTTGATGTCACCCTGATCTGTCATGCCCCACCGCCACCCCTACTCCCTTCAACCCTCCCTCTTTC

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ye Bi et al.
Frontiers in physiology, 11, 638-638 (2020-07-28)
SPS1-related proline/alanine-rich kinase (SPAK) plays important roles in regulating the function of numerous ion channels and transporters. With-no-lysine (WNK) kinase phosphorylates SPAK kinase to active the SPAK signaling pathway. Our previous studies indicated that WNK kinases regulate the activity of
Chih-Hao Shen et al.
BMC pulmonary medicine, 21(1), 58-58 (2021-02-17)
Hyperoxia downregulates the tight junction (TJ) proteins of the alveolar epithelium and leads to barrier dysfunction. Previous study has showed that STE20/SPS1-related proline/alanine-rich kinase (SPAK) interferes with the intestinal barrier function in mice. The aim of the present study is
Ken Yamada et al.
ACS chemical biology, 11(12), 3338-3346 (2016-10-08)
Protein kinases are known for their highly conserved adenosine triphosphate (ATP)-binding site, rendering the discovery of selective inhibitors a major challenge. In theory, allosteric inhibitors can achieve high selectivity by targeting less conserved regions of the kinases, often with an
Xiuyan Feng et al.
American journal of physiology. Renal physiology, 308(10), F1119-F1127 (2015-03-13)
Thiazide-sensitive sodium chloride cotransporter (NCC) plays an important role in maintaining blood pressure. Aldosterone is known to modulate NCC abundance. Previous studies reported that dietary salts modulated NCC abundance through either WNK4 [with no lysine (k) kinase 4]-SPAK (Ste20-related proline

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica