Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU043571

Sigma-Aldrich

MISSION® esiRNA

targeting human YY1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GTCACCATGTGGTCCTCAGATGAAAAAAAAGATATTGACCATGAGACAGTGGTTGAAGAACAGATCATTGGAGAGAACTCACCTCCTGATTATTCAGAATATATGACAGGAAAGAAACTTCCTCCTGGAGGAATACCTGGCATTGACCTCTCAGATCCCAAACAACTGGCAGAATTTGCTAGAATGAAGCCAAGAAAAATTAAAGAAGATGATGCTCCAAGAACAATAGCTTGCCCTCATAAAGGCTGCACAAAGATGTTCAGGGATAACTCGGCCATGAGAAAACATCTGCACACCCACGGTCCCAGAGTCCACGTCTGTGCAGAATGTGGCAAAGCTTTTGTTGAGAGTTCAAAACTAAAACGACACCAACTGGTTCATACTGGAGAGAAGCCCTTTCAGTGCA

Ensembl | Número de adesão de ser humano

ENSG00000100811

nº de adesão NCBI

NM_003403

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... YY1(7528) , YY1(7528)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

J-B Tian et al.
European review for medical and pharmacological sciences, 23(13), 5714-5729 (2019-07-13)
Increasing studies have confirmed long non-coding RNAs (lncRNAs) as novel regulators in tumorigenesis. LncRNA DDX11 antisense RNA 1 (DDX11-AS1) has been found to be abnormally expressed in several tumors. In this work, we aimed to evaluate its expressions and functions
Jinpiao Lin et al.
Journal of autoimmunity, 77, 67-75 (2016-11-11)
Previous studies have revealed a critical role of YY1, a "Yin Yang" transcription factor, in cancer development and progression. However, whether YY1 has any role in rheumatoid arthritis (RA) remains unknown. This study aims to explore the potential role of
Xin-Chun Zhang et al.
Biochemical and biophysical research communications, 502(2), 269-275 (2018-05-29)
Neuroinflammation plays a critical role in the process of neurodegenerative disorders, during which microglia, the principal resident immune cells in the central nervous system, are activated and produce proinflammatory mediators. Yin-Yang 1 (YY1), a multi-functional transcription factor, is widely expressed
Jiyeon Choi et al.
Nature communications, 11(1), 2718-2718 (2020-06-03)
Genome-wide association studies (GWAS) have identified ~20 melanoma susceptibility loci, most of which are not functionally characterized. Here we report an approach integrating massively-parallel reporter assays (MPRA) with cell-type-specific epigenome and expression quantitative trait loci (eQTL) to identify susceptibility genes/variants
Yan Zhang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 84, 1274-1281 (2016-11-05)
The microRNAs represent a class of noncoding RNAs with short length and play diverse roles in many biological processes. Despite tremendous effects have been devoted, the role of miR-635 in non-small cell lung cancer (NSCLC) remains elusive. Here we report
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica