Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU043091

Sigma-Aldrich

MISSION® esiRNA

targeting human ADM

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TGGCACACCAGATCTACCAGTTCACAGATAAGGACAAGGACAACGTCGCCCCCAGGAGCAAGATCAGCCCCCAGGGCTACGGCCGCCGGCGCCGGCGCTCCCTGCCCGAGGCCGGCCCGGGTCGGACTCTGGTGTCTTCTAAGCCACAAGCACACGGGGCTCCAGCCCCCCCGAGTGGAAGTGCTCCCCACTTTCTTTAGGATTTAGGCGCCCATGGTACAAGGAATAGTCGCGCAAGCATCCCGCTGGTGCCTCCCGGGACGAAGGACTTCCCGAGCGGTGTGGGGACCGGGCTCTGACAGCCCTGCGGAGACCCTGAGTCCGGGAGGCACCGTCCGGCGGCGAGCTCTGGCTTTGCAAGGGCCCCTCCTTCTGGGGGCTTCGCTTCCTTAGCCTTGCTCAGGTGCAAGTGCCCCAGGGGGCGGGGTGCAGAAGAATCCGAGTGTTTGCCAGGCTTAAGGA

Ensembl | Número de adesão de ser humano

ENSG00000148926

nº de adesão NCBI

NM_001124

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ADM(133) , ADM(133)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Lu Yao et al.
Archives of medical research, 50(1), 47-57 (2019-03-21)
Osteosarcoma is one of the most pernicious primary bone tumor characterized by high malignancy and metastasis, however its pathogenesis remain largely unknown. Our previous study showed elevated expression of adrenomedullin (ADM) is correlated with prognosis and disease severity in osteosarcoma
Carole-Anne Whigham et al.
Pregnancy hypertension, 16, 16-25 (2019-05-06)
Preeclampsia is a pregnancy complication associated with elevated placental secretion of anti-angiogenic factors, maternal endothelial dysfunction and end-organ injury. Adrenomedullin (ADM) is a pro-angiogenic peptide hormone which regulates blood pressure and vascular integrity. It is highly expressed in both the
Shaojie Zhang et al.
Biochemical and biophysical research communications, 464(4), 1048-1053 (2015-07-22)
Bronchopulmonary dysplasia (BPD) is a chronic lung disease of premature infants that is characterized by alveolar simplification and decreased lung angiogenesis. Hyperoxia-induced oxidative stress and inflammation contributes to the development of BPD in premature infants. Adrenomedullin (AM) is an endogenous
Tiechui Zhu et al.
Molecular medicine reports, 11(5), 3760-3766 (2015-01-15)
Renal tubular epithelial cells can enter the epithelial‑to‑mesenchymal transition (EMT) in response to chronic hypoxia. EMT is a process which involves the phenotypic conversion of epithelial cells, that is believed to have an important role in renal fibrosis. However, the

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica