Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU042081

Sigma-Aldrich

MISSION® esiRNA

targeting human PRKAA2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GCAGATTCTGTCTGCTGTGGATTACTGTCATAGGCATATGGTTGTTCATCGAGACCTGAAACCAGAGAATGTCCTGTTGGATGCACACATGAATGCCAAGATAGCCGATTTCGGATTATCTAATATGATGTCAGATGGTGAATTTCTGAGAACTAGTTGCGGATCTCCAAATTATGCAGCACCTGAAGTCATCTCAGGCAGATTGTATGCAGGTCCTGAAGTTGATATCTGGAGCTGTGGTGTTATCTTGTATGCTCTTCTTTGTGGCACCCTCCCATTTGATGATGAGCATGTACCTACGTTATTTAAGAAGATCCGAGGGGGTGTCTTTTATATCCCAGAATATCTCAATCGTTCTGTCGCCACTCTCCTGATGCATATGCTGCAGGTTGACCCACTGAAACGA

Ensembl | Número de adesão de ser humano

ENSG00000162409

nº de adesão NCBI

NM_006252

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PRKAA2(5563) , PRKAA2(5563)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
JBV
HYU
ZXU
WWU
JUU

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Wei-Wen Su et al.
International journal of medical sciences, 17(5), 678-684 (2020-03-27)
Background: Adenine exhibits potential anticancer activity against several types of malignancies. However, whether adenine has anticancer effects on hepatocellular carcinoma (HCC) cells is incompletely explored. Methods: Human HCC cell lines HepG2 and SK-Hep-1 (p53-wild type) and Hep3B (p53-deficient) were used
Meera Saxena et al.
Journal of cell science, 131(14) (2018-06-29)
The developmental programme of epithelial-mesenchymal transition (EMT), involving loss of epithelial and acquisition of mesenchymal properties, plays an important role in the invasion-metastasis cascade of cancer cells. In the present study, we show that activation of AMP-activated protein kinase (AMPK)
Lin Lin et al.
Frontiers in pharmacology, 10, 1617-1617 (2020-02-13)
The increase of blood pressure accelerates endothelial progenitor cells (EPCs) senescence, hence a significant reduction in the number of EPCs is common in patients with hypertension. Autophagy is a defense and stress regulation mechanism to assist cell homeostasis and organelle
Hua Yu et al.
International journal of oncology, 50(1), 161-172 (2016-12-07)
Caulerpin, a secondary metabolite from the marine invasive green algae Caulerpa cylindracea is known to induce mitochondrial dysfunctions. In this study, the anticancer property of caulerpin was assessed in a panel of colorectal cancer cell lines. We demonstrated that caulerpin
Yingshuai Zhao et al.
Cardiology, 143(1), 1-10 (2019-07-16)
The aberrant proliferation and migration of vascular smooth muscle cells (VSMCs) in the vascular wall are crucial pathological events involved in cardiovascular impairments including hypertension, heart failure, and atherosclerosis. At the molecular level, the mammalian target of rapamycin (mTOR)-ribosomal protein
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica