Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU037471

Sigma-Aldrich

MISSION® esiRNA

targeting human ECT2

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51
Preço e disponibilidade não estão disponíveis no momento.

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TTTGGATTCTCCGGAATTTGAAAATGTATTTGTAGTCACGGACTTTCAGGATTCTGTCTTTAATGACCTCTACAAGGCTGATTGTAGAGTTATTGGACCACCAGTTGTATTAAATTGTTCACAAAAAGGAGAGCCTTTGCCATTTTCATGTCGCCCGTTGTATTGTACAAGTATGATGAATCTAGTACTATGCTTTACTGGATTTAGGAAAAAAGAAGAACTAGTCAGGTTGGTGACATTGGTCCATCACATGGGTGGAGTTATTCGAAAAGACTTTAATTCAAAAGTTACACATTTGGTGGCAAATTGTACACAAGGAGAAAAATTCAGGGTTGCTGTGAGTCTAGGTACTCCAATTATGAAGCCAGAATGGATTTATAAAGCTTGGGAAAGGCGGAATGAACAGGAT

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Zeinab Kosibaty et al.
Laboratory investigation; a journal of technical methods and pathology, 99(4), 551-567 (2018-12-14)
Epithelial cell transforming sequence 2 (ECT2), a guanine nucleotide exchange factor, is predominantly localized in the nucleus of non-transformed cells and functions to regulate cytokinesis. ECT2 is also localized in the cytoplasm of cancer cells. Aberrant cytoplasmic expression of ECT2
Zheng-Qing Fang et al.
Journal of cellular biochemistry, 119(10), 8317-8324 (2018-06-23)
We intended to evaluate miR-490-5p expression in hepatocellular carcinoma (HCC) tissues and detect the potential targets of miR-490-5p. In vitro experiments were conducted to further investigate the biological function of miR-490-5p on HCC cell metastasis. We investigated the abnormally expressed
J Sebastián Gómez-Cavazos et al.
Current biology : CB, 30(16), 3101-3115 (2020-07-04)
Cytokinesis partitions the cell contents to complete mitosis. During cytokinesis, polo-like kinase 1 (PLK1) activates the small GTPase RhoA to assemble a contractile actomyosin ring. PLK1 is proposed to pattern RhoA activation by creating a docking site on the central
Qi Zhang et al.
Theranostics, 10(23), 10769-10790 (2020-09-16)
Rationale: A number of guanine nucleotide exchange factors (GEFs) including epithelial cell transforming factor ECT2 are believed to drive carcinogenesis through activating distinct oncogenic GTPases. Yet, whether GEF-independent activity of ECT2 also plays a role in tumorigenesis remains unclear. Methods:

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica