Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU037241

Sigma-Aldrich

MISSION® esiRNA

targeting human SMAD3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GGCTTTGAGGCTGTCTACCAGTTGACCCGAATGTGCACCATCCGCATGAGCTTCGTCAAAGGCTGGGGAGCGGAGTACAGGAGACAGACTGTGACCAGTACCCCCTGCTGGATTGAGCTGCACCTGAATGGGCCTTTGCAGTGGCTTGACAAGGTCCTCACCCAGATGGGCTCCCCAAGCATCCGCTGTTCCAGTGTGTCTTAGAGACATCAAGTATGGTAGGGGAGGGCAGGCTTGGGGAAAATGGCCATGCAGGAGGTGGAGAAAATTGGAACTCTACTCAACCCATTGTTGTCAAGGAAGAAGAAATCTTTCTCCCTCAACTGAAGGGGTGCACCCACCTGTTTTCTGAAACACACGAGCAAACCCAGAGGTGGATGTTATGAACAGCTGTGTCTGCCAAACACATTTACCCTTTGGCCCCACTTTGAAGGGCAAGAAATGGCGTCTGCTCTGGTGGCTTAAGTGA

Ensembl | Número de adesão de ser humano

ENSG00000166949

nº de adesão NCBI

NM_005902

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SMAD3(4088) , SMAD3(4088)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

S Muppala et al.
Oncogene, 36(36), 5189-5198 (2017-05-10)
TGF-β is a multifunctional cytokine affecting many cell types and implicated in tissue remodeling processes. Due to its many functions and cell-specific effects, the consequences of TGF-β signaling are process-and stage-dependent, and it is not uncommon that TGF-β exerts distinct
Zheng Jiang et al.
Journal of biochemistry, 165(4), 317-322 (2018-12-12)
Radiotherapy is the major treatment modality for malignant glioma. However, the treatment response of radiotherapy is suboptimal due to resistance. Here we aimed to explore the effect and mechanism of Mothers against decapentaplegic homologue (SMAD3) silencing in sensitizing malignant glioma
Nao Hiwatashi et al.
The Laryngoscope, 127(9), E308-E316 (2017-05-26)
Recent reports highlight the efficacy of small interfering RNA (siRNA) targeting SMAD3 to regulate transforming growth factor β (TGF-β)-mediated fibroplasia in vocal fold fibroblasts. The current study sought to investigate SMAD3 expression during wound healing in vivo and quantify the
Tianli Cheng et al.
International journal of oncology, 45(5), 1977-1988 (2014-09-02)
Altered expression of miRNAs contributes to development and progression of non-small cell lung cancer (NSCLC), while transforming growth factor-β (TGF-β) promotes NSCLC cell epithelial-mesenchymal transition. This study aimed to investigate the effects of TGF-β-induced miR‑143 expression in regulation of NSCLC
Ayesha Ghayur et al.
American journal of physiology. Renal physiology, 317(1), F152-F162 (2019-05-30)
Glomerulonephritis (GN) is a common cause of end-stage kidney disease and is characterized by glomerular inflammation, hematuria, proteinuria, and progressive renal dysfunction. Transforming growth factor (TGF)-β is involved in glomerulosclerosis and interstitial fibrosis. TGF-β activates multiple signaling pathways, including the
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica