Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU036931

Sigma-Aldrich

MISSION® esiRNA

targeting human ATG12

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CGAACCATCCAAGGACTCATTGACTTCATCAAAAAGTTTCTTAAACTTGTGGCCTCAGAACAGTTGTTTATTTATGTGAATCAGTCCTTTGCTCCTTCCCCAGACCAAGAAGTTGGAACTCTCTATGAGTGTTTTGGCAGTGATGGTAAACTGGTTTTACATTACTGCAAGTCTCAGGCGTGGGGATGAACCACAAAGAAAATCAACTTGCTACTACATGAAATGGATTTTCACGGAAGAGACAGCTCTGAAAAGTTTTGATGCTTGTGGCAAGAGACTTAACAGATGTGATCTATTTAGTATGTGTCTACTCTATGTTTATGCATAAGAAAACATCCATAGCATGAATGGACTCAGAAAAATGTGATTTGTATTAATGCACCAGTCATCATAAAAGATGGTCATGATAGTACACCCATTGCTCCTACTTGTTACTATTATTGCTGCAGATCTGCCTCCAAGGTTGAAA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yingqiang Liu et al.
Cell death & disease, 11(3), 175-175 (2020-03-08)
Colorectal cancer (CRC) is a global healthcare problem. Radioresistance is a huge setback for CRC radiotherapy. In this text, the roles and molecular mechanisms of long non-coding RNA HOTAIR in CRC tumorigenesis and radioresistance were further investigated. ATG12 mRNA, HOTAIR
Sachiko Matsuzaki et al.
British journal of pharmacology, 175(10), 1637-1653 (2018-02-20)
A high recurrence rate after medical treatment is a major clinical problem for patients with endometriosis. Here, we have evaluated the in vitro effects of combined treatment with MK2206 (an AKT inhibitor) + chloroquine on cell growth and regrowth of endometriotic stromal
Yongqiang Chen et al.
Cancers, 13(5) (2021-04-04)
The epidermal growth factor receptor (EGFR) family member erb-b2 receptor tyrosine kinase 2 (ERBB2) is overexpressed in many types of cancers leading to (radio- and chemotherapy) treatment resistance, whereas the underlying mechanisms are still unclear. Autophagy is known to contribute
Sun-Jung Cho et al.
Autophagy, 11(1), 100-112 (2014-12-09)
Autophagy is one of the main mechanisms in the pathophysiology of neurodegenerative disease. The accumulation of autophagic vacuoles (AVs) in affected neurons is responsible for amyloid-β (Aβ) production. Previously, we reported that SUMO1 (small ubiquitin-like modifier 1) increases Aβ levels.

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica