Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU036781

Sigma-Aldrich

MISSION® esiRNA

targeting human CYP19A1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GGTGATGATGAAAGCCATCCTCGTTACACTTCTGAGACGATTCCACGTGAAGACATTGCAAGGACAGTGTGTTGAGAGCATACAGAAGATACACGACTTGTCCTTGCACCCAGATGAGACTAAAAACATGCTGGAAATGATCTTTACCCCAAGAAACTCAGACAGGTGTCTGGAACACTAGAGAAGGCTGGTCAGTACCCACTCTGGAGCATTTCTCATCAGTAGTTCACATACAAATCATCCATCCTTGCCAATAGTGTCATCCTCACAGTGAACACTCAGTGGCCCATGGCATTTTATAGGCATACCTCCTATGGGTTGTCACCAAGCTAGGTGCTATTTGTCATCTGCTCCTGTTCACACCAGAGAACCAGGCTACAAGAGAAAAAGCAGAGGCCAAGAGTTTGAGG

Ensembl | Número de adesão de ser humano

ENSG00000137869

nº de adesão NCBI

NM_000103

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CYP19A1(1588) , CYP19A1(1588)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Taylor Vanduzer et al.
The Journal of reproduction and development, 60(6), 476-482 (2014-08-12)
Nineteen cycling ewes underwent transrectal ultrasonography of ovaries followed by ovariectomies during the growth phase of the first follicular wave of the interovulatory interval or the proestrus/estrus phase of the cycle. Quantitative ultrasonographic characteristics of the antrum and follicular wall
Yu Chen et al.
International journal of molecular medicine, 36(3), 725-732 (2015-07-03)
Endometriosis is a common type of estrogen‑dependent, gynecological and chronic inflammatory disease. Epigenetics refers to changes in gene expression that occur without altering the DNA sequence or DNA content. Histone modification dominates epigenetics, and histone acetylation is the most extensively

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica