Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU035991

Sigma-Aldrich

MISSION® esiRNA

targeting human PRKAB1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GGGTCCTTCAACAACTGGAGTAAACTTCCCCTCACCAGAAGCCACAATAACTTTGTAGCCATCCTGGATCTGCCGGAAGGAGAGCATCAGTACAAGTTCTTTGTGGATGGTCAGTGGACGCACGACCCTTCCGAGCCCATAGTAACCAGCCAGCTTGGCACAGTTAACAACATCATTCAAGTGAAGAAAACTGACTTTGAAGTATTTGATGCTTTAATGGTGGATTCCCAAAAGTGCTCCGATGTGTCTGAGCTGTCCAGTTCTCCCCCAGGACCCTACCATCAGGAGCCCTACGTCTGCAAACCCGAAGAGCGCTTTCGGGCACCCCCTATTCTCCCCCCACATCTCCTCCAGGTCATCCTGAACAAGGACACGGGGATTTCCTGTGATCCAGCTTTGCTTCCTGAGCCCAATCACGTCATGCTGAACCACCTATACGCGCTGTCTATCAAGGATGGAGTGATGGTGCTC

Ensembl | Número de adesão de ser humano

ENSG00000111725

nº de adesão NCBI

NM_006253

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PRKAB1(5564) , PRKAB1(5564)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Christine L Hammond et al.
Investigative ophthalmology & visual science, 62(1), 29-29 (2021-01-29)
Thyroid eye disease (TED) is a condition that causes the tissue behind the eye to become inflamed and can result in excessive fatty tissue accumulation in the orbit. Two subpopulations of fibroblasts reside in the orbit: those that highly express
Jiaheng Xie et al.
Investigative ophthalmology & visual science, 62(3), 29-29 (2021-03-23)
The human PDZK1 gene is located in a genomic susceptibility region for neurodevelopmental disorders. A genome-wide association study identified links between PDZK1 polymorphisms and altered visual contrast sensitivity, an endophenotype for schizophrenia and autism spectrum disorder. The PDZK1 protein is

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica