Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU035901

Sigma-Aldrich

MISSION® esiRNA

targeting human AP2M1

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00


Previsão de entrega em28 de abril de 2025



Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00


Previsão de entrega em28 de abril de 2025


descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CAAAGGCACAGCTGATGAAACAAGCAAGAGCGGGAAGCAATCAATTGCCATTGATGACTGCACCTTCCACCAGTGTGTGCGACTCAGCAAGTTTGACTCTGAACGCAGCATCAGCTTTATCCCGCCAGATGGAGAGTTTGAGCTTATGAGGTATCGCACAACCAAGGACATCATCCTTCCCTTCCGGGTGATCCCGCTAGTGCGAGAAGTGGGACGCACCAAACTGGAGGTCAAGGTGGTCATCAAGTCCAACTTTAAACCCTCACTGCTGGCTCAGAAGATCGAGGTGAGGATCCCAACCCCACTGAACACAAGCGGGGTGCAGGTGATCTGCATGAAGGGGAAGGCCAAGTACAAGGCCAGCGAGAATGCCATCGTGTGGAAGATCAAGCGCATGGCAGGCATGAAGGAATCGCAGATCAGCGCAGAGATTGAGCTTCTGCCTACCAACGACAAGAAGAAATGGGCTCG

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Shuofeng Yuan et al.
Science advances, 6(35), eaba7910-eaba7910 (2020-09-15)
Targeting a universal host protein exploited by most viruses would be a game-changing strategy that offers broad-spectrum solution and rapid pandemic control including the current COVID-19. Here, we found a common YxxØ-motif of multiple viruses that exploits host AP2M1 for
Frederic Daste et al.
The Journal of cell biology, 216(11), 3745-3765 (2017-09-20)
The conditional use of actin during clathrin-mediated endocytosis in mammalian cells suggests that the cell controls whether and how actin is used. Using a combination of biochemical reconstitution and mammalian cell culture, we elucidate a mechanism by which the coincidence
Pin Lu et al.
PloS one, 12(10), e0185992-e0185992 (2017-10-06)
Some RNA species, especially microRNAs, are non-randomly sorted into exosomes, but how selectivity of RNA exosomal sorting is achieved is unknown. We found that all three variants of RNA-binding ubiquitin E3 ligase (MEX3C)-MEX3C-1, MEX3C-2, and MEX3C-3 -interact with adaptor-related protein

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica