Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU035901

Sigma-Aldrich

MISSION® esiRNA

targeting human AP2M1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CAAAGGCACAGCTGATGAAACAAGCAAGAGCGGGAAGCAATCAATTGCCATTGATGACTGCACCTTCCACCAGTGTGTGCGACTCAGCAAGTTTGACTCTGAACGCAGCATCAGCTTTATCCCGCCAGATGGAGAGTTTGAGCTTATGAGGTATCGCACAACCAAGGACATCATCCTTCCCTTCCGGGTGATCCCGCTAGTGCGAGAAGTGGGACGCACCAAACTGGAGGTCAAGGTGGTCATCAAGTCCAACTTTAAACCCTCACTGCTGGCTCAGAAGATCGAGGTGAGGATCCCAACCCCACTGAACACAAGCGGGGTGCAGGTGATCTGCATGAAGGGGAAGGCCAAGTACAAGGCCAGCGAGAATGCCATCGTGTGGAAGATCAAGCGCATGGCAGGCATGAAGGAATCGCAGATCAGCGCAGAGATTGAGCTTCTGCCTACCAACGACAAGAAGAAATGGGCTCG

Ensembl | Número de adesão de ser humano

ENSG00000161203

nº de adesão NCBI

NM_004068

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... AP2M1(1173) , AP2M1(1173)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
EXU
JLU
HKU
YET
RYS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Frederic Daste et al.
The Journal of cell biology, 216(11), 3745-3765 (2017-09-20)
The conditional use of actin during clathrin-mediated endocytosis in mammalian cells suggests that the cell controls whether and how actin is used. Using a combination of biochemical reconstitution and mammalian cell culture, we elucidate a mechanism by which the coincidence
Shuofeng Yuan et al.
Science advances, 6(35), eaba7910-eaba7910 (2020-09-15)
Targeting a universal host protein exploited by most viruses would be a game-changing strategy that offers broad-spectrum solution and rapid pandemic control including the current COVID-19. Here, we found a common YxxØ-motif of multiple viruses that exploits host AP2M1 for
Pin Lu et al.
PloS one, 12(10), e0185992-e0185992 (2017-10-06)
Some RNA species, especially microRNAs, are non-randomly sorted into exosomes, but how selectivity of RNA exosomal sorting is achieved is unknown. We found that all three variants of RNA-binding ubiquitin E3 ligase (MEX3C)-MEX3C-1, MEX3C-2, and MEX3C-3 -interact with adaptor-related protein

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica