Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU034511

Sigma-Aldrich

MISSION® esiRNA

targeting human TBK1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CCCGGCTGGTATAACAAGAGGATTGCCTGATCCAGCCAAGATGCAGAGCACTTCTAATCATCTGTGGCTTTTATCTGATATTTTAGGCCAAGGAGCTACTGCAAATGTCTTTCGTGGAAGACATAAGAAAACTGGTGATTTATTTGCTATCAAAGTATTTAATAACATAAGCTTCCTTCGTCCAGTGGATGTTCAAATGAGAGAATTTGAAGTGTTGAAAAAACTCAATCACAAAAATATTGTCAAATTATTTGCTATTGAAGAGGAGACAACAACAAGACATAAAGTACTTATTATGGAATTTTGTCCATGTGGGAGTTTATACACTGTTTTAGAAGAACCTTCTAATGCCTATGGACTACCAGAATCTGAATTCTTAATTGTTTTGCGAGATGTGGTGGGTGGAATGAAT

Ensembl | Número de adesão de ser humano

ENSG00000183735

nº de adesão NCBI

NM_013254

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... TBK1(29110) , TBK1(29110)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
ADV
JUU
QCS
KBU
IYT

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Kaixuan Cui et al.
Biochemical and biophysical research communications, 503(1), 202-208 (2018-06-05)
choroidal neovascularization (CNV), a characteristic of wet age-related macular degeneration (AMD), causes severe vision loss among elderly patients. TANK-binding kinase 1 (TBK1) is a ubiquitously expressed serine-threonine kinase and is found to induce endothelial cells proliferation, represent a novel mediator
Yanyu Zhang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(7), 7822-7832 (2019-03-27)
Platelets can promote several stages of the metastatic process and thus contribute to malignant progression. As an example, platelets promote invasive properties of tumor cells by induction of epithelial to mesenchymal transition (EMT). In this study, we show that tumor
Yong Cheng et al.
EMBO reports, 20(3) (2019-01-27)
Extracellular vesicles (EVs) have been shown to carry microbial components and function in the host defense against infections. In this study, we demonstrate that Mycobacterium tuberculosis (M.tb) RNA is delivered into macrophage-derived EVs through an M.tb SecA2-dependent pathway and that
Chaping Cheng et al.
Theranostics, 8(17), 4633-4648 (2018-10-04)
Tumor metastasis is the major cause of death for prostate cancer (PCa) patients. However, the treatment options for metastatic PCa are very limited. Epithelial-mesenchymal transition (EMT) has been reported to be an indispensable step for tumor metastasis and is suggested
Ricardo J Antonia et al.
Scientific reports, 9(1), 13470-13470 (2019-09-19)
While best known for its role in the innate immune system, the TANK-binding kinase 1 (TBK1) is now known to play a role in modulating cellular growth and autophagy. One of the major ways that TBK1 accomplishes this task is
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica