Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU034241

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC13A2

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CTTCAGCCTGCACTCTTTCCCCTCCTGGGCACAGTCCAACACCACAGCCCAGTGCCTGCCAAGCCTGGCCAACACCACCACACCAAGCCCCTAGGCTGGGGCACAGCCTGGCCATGCCCAGGAAGACCCACCCCATTCCCACTCCTCTGAGCCCGGAGGGGACACCCCAAGCTCCAAGCTCCAAGCTCCAGGCCAAAGGCTGAAAGGCACGTGTGTACATAATCTCTTGCGTGTCTGTAAGGAAGGGGTGTATGCTCAGTTTCCTATGTGCTGGAATAAAAGGTGTGTGCATGTGTGTGTGCGCATATGTGTGCGCCTGCATGGATGTGAGGGGTGTGTGACGTGAGGCTATCTGAGGGGGGCTGTGTGCATGCACATGATCCTAGGTATGTATGTTGGACAGTGCACACGTGTGTGTTCACAGACAATACAACATGCCCTCTCTGGTGCCCCAGGTCTTGGTATCCCCAGCT

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Neil R Hackett et al.
PloS one, 6(5), e18378-e18378 (2011-05-17)
The human airway epithelium consists of 4 major cell types: ciliated, secretory, columnar and basal cells. During natural turnover and in response to injury, the airway basal cells function as stem/progenitor cells for the other airway cell types. The objective
Lynne Bingle et al.
Histochemistry and cell biology, 138(5), 749-758 (2012-07-07)
Although the biology the PLUNC (recently renamed BPI fold, BPIF) family of secreted proteins is poorly understood, multiple array based studies have suggested that some are differentially expressed in lung diseases. We have examined the expression of BPIFB1 (LPLUNC1), the
Lynne Bingle et al.
Respiratory research, 7, 61-61 (2006-04-08)
The Whey Acidic Protein domain is an evolutionarily conserved motif found in a number of proteins, the best studied of which are antiproteinases involved in the innate immune defence of multiple epithelia. We recently characterised the WFDC2 gene which encodes
Loren Masterson et al.
Journal of skin cancer, 2014, 596459-596459 (2014-03-19)
Due to the rarity of Merkel cell carcinoma (MCC), prospective clinical trials have not been practical. This study aimed to identify biomarkers with prognostic significance. While sixty-two patients were identified who were treated for MCC at our institution, only seventeen
Lynne Bingle et al.
Respiratory research, 8, 79-79 (2007-11-09)
Short PLUNC1 (SPLUNC1) is the founding member of a family of proteins (PLUNCS) expressed in the upper respiratory tract and oral cavity, which may function in host defence. It is one of the most highly expressed genes in the upper

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica