Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU033921

Sigma-Aldrich

MISSION® esiRNA

targeting human TUFM

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51
Preço e disponibilidade não estão disponíveis no momento.

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GAAGGGAGACGAGTGTGAGCTCCTAGGACATAGCAAGAACATCCGCACTGTGGTGACAGGCATTGAGATGTTCCACAAGAGCCTGGAGAGGGCCGAGGCCGGAGATAACCTCGGGGCCCTGGTCCGAGGCTTGAAGCGGGAGGACTTGCGGCGGGGCCTGGTCATGGTCAAGCCAGGTTCCATCAAGCCCCACCAGAAGGTGGAGGCCCAGGTTTACATCCTCAGCAAGGAGGAAGGTGGCCGCCACAAGCCCTTTGTGTCCCACTTCATGCCTGTCATGTTCTCCCTGACTTGGGACATGGCCTGTCGGATTATCCTGCCCCCAGAGAAGGAGCTTGCCATGCCCGGGGAGGACCTGAAGTTCAACCTAATCTTGCGGCAGCCAATGATCTTAGAGAAAGGCCAGCGTTTC

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Xiaoyuan Weng et al.
Oncology letters, 20(5), 250-250 (2020-10-01)
Gastrointestinal stromal tumors (GISTs) are the most common pathologic type of mesenchymal tumor in the digestive tract. Patients with GIST face the risk of metastasis, postoperative recurrence and imatinib mesylate (IM) resistance. Mitochondrial Tu translation elongation factor (TUFM) is highly
Keiichi Tamai et al.
Scientific reports, 10(1), 21592-21592 (2020-12-11)
Cancer stem cells (CSCs) define a subpopulation of cancer cells that are resistant to therapy. However, little is known of how CSC characteristics are regulated. We previously showed that dormant cancer stem cells are enriched with a CD274low fraction of
Dasol Kim et al.
Communications biology, 4(1), 1-1 (2021-01-06)
Disorders of autophagy, a key regulator of cellular homeostasis, cause a number of human diseases. Due to the role of autophagy in metabolic dysregulation, there is a need to identify autophagy regulators as therapeutic targets. To address this need, we

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica