Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU032751

Sigma-Aldrich

MISSION® esiRNA

targeting human THBS1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ATGGAATTGGTGATGCCTGTGATGATGACGATGACAATGATAAAATTCCAGATGACAGGGACAACTGTCCATTCCATTACAACCCAGCTCAGTATGACTATGACAGAGATGATGTGGGAGACCGCTGTGACAACTGTCCCTACAACCACAACCCAGATCAGGCAGACACAGACAACAATGGGGAAGGAGACGCCTGTGCTGCAGACATTGATGGAGACGGTATCCTCAATGAACGGGACAACTGCCAGTACGTCTACAATGTGGACCAGAGAGACACTGATATGGATGGGGTTGGAGATCAGTGTGACAATTGCCCCTTGGAACACAATCCGGATCAGCTGGACTCTGACTCAGACCGCATTGGAGATACCTGTGACAACAATCAGGATATTGATGAAGATGGCCACCAGAAC

Ensembl | Número de adesão de ser humano

ENSG00000137801

nº de adesão NCBI

NM_003246

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... THBS1(7057) , THBS1(7057)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Shingo Semba et al.
Journal of biomedical materials research. Part A, 109(3), 354-364 (2020-06-05)
We previously demonstrated that a synthetic negatively charged poly(2-acrylamido-2-methylpropanesulfonic acid) (PAMPS) gel induced chondrogenic differentiation of ATDC5 cells. In this study, we clarified the underlying molecular mechanism, in particular, focusing on the events that occurred at the interface between the
Jeneen Panezai et al.
Immunology, 152(2), 308-327 (2017-06-06)
Cell adhesion is generally considered to depend on positive regulation through ligation of integrins and cytokine receptors. However, here we show that T-cell adhesion, and notably also T-cell receptor (TCR) -induced activation, are subject to constant suppression through shedding of
Hui Hu et al.
Clinical science (London, England : 1979), 133(14), 1629-1644 (2019-07-19)
Background: Our previous studies observed that administration of exosomes from endothelial progenitor cells (EPC) facilitated vascular repair in the rat model of balloon injury. However, the molecular events underlying this process remain elusive. Here, we aim to interrogate the key
Ho-Jun Shih et al.
American journal of cancer research, 10(6), 1728-1744 (2020-07-10)
Insulin-like growth factor binding protein-3 (IGFBP3) has been postulated to be a mediator of growth suppression signaling. It was shown to function as a suppressor of invasion in epithelial ovarian cancer (EOC). In this study, we identified an angiogenesis inhibitor
Gun-Hoo Park et al.
Nature neuroscience, 23(11), 1352-1364 (2020-10-25)
The mechanisms by which prenatal immune activation increase the risk for neuropsychiatric disorders are unclear. Here, we generated developmental cortical interneurons (cINs)-which are known to be affected in schizophrenia (SCZ) when matured-from induced pluripotent stem cells (iPSCs) derived from healthy
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica