Pular para o conteúdo
Merck
Todas as fotos(2)

Documentos

EHU032581

Sigma-Aldrich

MISSION® esiRNA

targeting human CAPN1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(2)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GACATGGAGATCAGCGTGAAGGAGTTGCGGACAATCCTCAATAGGATCATCAGCAAACACAAAGACCTGCGGACCAAGGGCTTCAGCCTAGAGTCGTGCCGCAGCATGGTGAACCTCATGGATCGTGATGGCAATGGGAAGCTGGGCCTGGTGGAGTTCAACATCCTGTGGAACCGCATCCGGAATTACCTGTCCATCTTCCGGAAGTTTGACCTGGACAAGTCGGGCAGCATGAGTGCCTACGAGATGCGGATGGCCATTGAGTCGGCAGGCTTCAAGCTCAACAAGAAGCTGTACGAGCTCATCATCACCCGCTACTCGGAGCCCGACCTGGCGGTCGACTTTGACAATTTCGTTTGCTGCCTGGTGCGGCTAGAGACCATGTTCCGATTTTTCAAAACTCTGGACACAGATCTGGATGGAGTTGTGACCTTTGACTTGTTTAAGTGGTTGCAGCTGACCATGTTTGCATGAGG

Ensembl | Número de adesão de ser humano

ENSG00000014216

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CAPN1(823) , CAPN1(823)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Meei-Ling Sheu et al.
Oncotarget, 8(12), 19376-19388 (2016-12-31)
Ochratoxin A (OTA) contaminated food increases reactive oxygen species (ROS) production in glomerulus and causes glomerulopathy. The molecular mechanisms still remain uncertain. In this study, we used mouse and rat glomerular mesangial cells and delineate the signaling pathway behind the
L M Yu et al.
Clinical & translational oncology : official publication of the Federation of Spanish Oncology Societies and of the National Cancer Institute of Mexico, 21(7), 924-932 (2018-12-20)
Pancreatic cancer (PC) is a highly aggressive and metastatic disease, with an elevated mortality rate. It is, therefore, crucial to assess factors affecting the prognosis of PC patients. Meanwhile, calpain-1 is associated with malignant tumor progression and metastasis. Thus, it
Mathieu Chocry et al.
Oncotarget, 8(61), 103710-103730 (2017-12-22)
Oxaliplatin is a major treatment for metastatic colorectal cancer, however its effectiveness is greatly diminished by the development of resistances. Our previous work has shown that oxaliplatin efficacy depends on the reactive oxygen species (ROS) produced by Nox1. In this

Artigos

esiRNA Knockdown Efficiency Tested by Western Blotting

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica