Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU031731

Sigma-Aldrich

MISSION® esiRNA

targeting human PTGER4

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TGCGAGTATTCGTCAACCAGTTATATCAGCCAAGTTTGGAGCGAGAAGTCAGTAAAAATCCAGATTTGCAGGCCATCCGAATTGCTTCTGTGAACCCCATCCTAGACCCCTGGATATATATCCTCCTGAGAAAGACAGTGCTCAGTAAAGCAATAGAGAAGATCAAATGCCTCTTCTGCCGCATTGGCGGGTCCCGCAGGGAGCGCTCCGGACAGCACTGCTCAGACAGTCAAAGGACATCTTCTGCCATGTCAGGCCACTCTCGCTCCTTCATCTCCCGGGAGCTGAAGGAGATCAGCAGTACATCTCAGACCCTCCTGCCAGACCTCTCACTGCCAGACCTCAGTGAAAATGGCCTTGGAGGCAGGAATTTGCTTCCAGGTGTGCCTGGCATGGGCCTGGCCCAGGAAGACACCACCTCACTGAGGACTTTGCGAATATCAGAGACCTCAGACTCTTCACAGGGTCAGGACTCAGA

Ensembl | Número de adesão de ser humano

ENSG00000171522

nº de adesão NCBI

NM_000958

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PTGER4(5734) , PTGER4(5734)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Felix Tönisen et al.
European journal of cell biology, 96(2), 218-226 (2017-01-18)
The production of Prostaglandin E
Pinki Nandi et al.
BMC cancer, 17(1), 11-11 (2017-01-07)
Lymphatic metastasis, facilitated by lymphangiogenesis is a common occurrence in breast cancer, the molecular mechanisms remaining incompletely understood. We had earlier shown that cyclooxygenase (COX)-2 expression by human or murine breast cancer cells promoted lymphangiogenesis and lymphatic metastasis by upregulating
Sonja Rittchen et al.
Biochemical pharmacology, 182, 114277-114277 (2020-10-11)
Life-threatening inflammatory conditions such as acute respiratory distress syndrome or sepsis often go hand in hand with severe vascular leakage. During inflammation, endothelial cell integrity and intact barrier function are crucial to limit leukocyte and plasma extravasation. Prostaglandin D2 (PGD2)
Dingzhi Wang et al.
Gastroenterology, 149(7), 1884-1895 (2015-08-12)
Inflammation may contribute to the formation, maintenance, and expansion of cancer stem cells (CSCs), which have the capacity for self-renewal, differentiation, and resistance to cytotoxic agents. We investigated the effects of the inflammatory mediator prostaglandin E2 (PGE2) on colorectal CSC

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica