Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU031291

Sigma-Aldrich

MISSION® esiRNA

targeting human DKC1

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em22 de maio de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em22 de maio de 2025

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TGTGTGCACCTTGGTTTGTTATTGGGAGTTGGTGGTCAGATGCAGGAGCTTCGGAGGGTTCGTTCTGGAGTCATGAGTGAAAAGGACCACATGGTGACAATGCATGATGTGCTTGATGCTCAGTGGCTGTATGATAACCACAAGGATGAGAGTTACCTGCGGCGAGTTGTTTACCCTTTGGAAAAGCTGTTGACATCTCATAAACGGCTGGTTATGAAAGACAGTGCAGTAAATGCCATCTGCTATGGGGCCAAGATTATGCTTCCAGGTGTTCTTCGATATGAGGACGGCATTGAGGTCAATCAGGAGATTGTGGTTATCACCACCAAAGGAGAAGCAATCTGCATGGCTATTGCATTAATGACCACAGCGGTCATCTCTACCTGCGACCATGGTATAGTAGCCAAGATCAAGAGAGTGATCATGGAGAGAGACACTTACCCTCGGAAGTGGGGTTTAGGTCCAAAGGCAAGTCAGA

Ensembl | Número de adesão de ser humano

ENSG00000130826

nº de adesão NCBI

NM_001363

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... DKC1(1736) , DKC1(1736)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
QCS
FQR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Vahid Khoddami et al.
Proceedings of the National Academy of Sciences of the United States of America, 116(14), 6784-6789 (2019-03-16)
The breadth and importance of RNA modifications are growing rapidly as modified ribonucleotides can impact the sequence, structure, function, stability, and fate of RNAs and their interactions with other molecules. Therefore, knowing cellular RNA modifications at single-base resolution could provide
Khloud A Elsharawy et al.
British journal of cancer, 123(10), 1543-1552 (2020-09-02)
Hypertrophy of the nucleolus is a distinctive cytological feature of malignant cells and corresponds to aggressive behaviour. This study aimed to identify the key gene associated with nucleolar prominence (NP) in breast cancer (BC) and determine its prognostic significance. From
Nunzia Di Maio et al.
FEBS open bio, 7(10), 1453-1468 (2017-10-06)
Dyskerin is an essential, conserved, multifunctional protein found in the nucleolus, whose loss of function causes the rare genetic diseases X-linked dyskeratosis congenita and Hoyeraal-Hreidarsson syndrome. To further investigate the wide range of dyskerin's biological roles, we set up stable
Meng Zhang et al.
Oncology reports, 40(2), 968-978 (2018-06-15)
DKC1, an X‑linked gene encoding dyskerin at Xq28, is a crucial component of the telomerase complex and is indispensable for normal telomere function and the post‑-transcriptional modification of precursor rRNA. It has been revealed to exert diverse biological functions and
Pingfu Hou et al.
British journal of cancer, 122(5), 668-679 (2019-12-21)
Dyskeratosis congenita 1 (DKC1) is dysregulated in several cancers. However, the expression and function of DKC1 in colorectal cancer (CRC) is rarely reported. Tissue microarrays (TAMs) including 411 cases of CRC tissues and corresponding paracancerous tissues were used to examine
Exibir todos os documentos relacionados

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica