Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU028931

Sigma-Aldrich

MISSION® esiRNA

targeting human CTSG

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ATAATCAGCGGACCATCCAGAATGACATCATGTTATTGCAGCTGAGCAGAAGAGTCAGACGGAATCGAAACGTGAACCCAGTGGCTCTGCCTAGAGCCCAGGAGGGACTGAGACCCGGGACGCTGTGCACTGTGGCCGGCTGGGGCAGGGTCAGCATGAGGAGGGGAACAGATACACTCCGAGAGGTGCAGCTGAGAGTGCAGAGGGATAGGCAGTGCCTCCGCATCTTCGGTTCCTACGACCCCCGAAGGCAGATTTGTGTGGGGGACCGGCGGGAACGGAAGGCTGCCTTCAAGGGGGATTCCGGAGGCCCCCTGCTGTGTAACAATGTGGCCCACGGCATCGTCTCCTATGGAAAGTCGTCAGGGGTTCCTCCAGAAGTCTTCACCAGGGTCTCAAGTTTCCTGCCCTGGATA

Ensembl | Número de adesão de ser humano

ENSG00000100448

nº de adesão NCBI

NM_001911

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CTSG(1511) , CTSG(1511)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Kyung Ho Han et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 30(2), 738-747 (2015-10-21)
We have devised a method of using intracellular combinatorial libraries to select antibodies that control cell fates. Many agonist antibodies have been selected with this method, and the process appears to be limited only by the availability of a phenotypic
S K Sengodan et al.
Oncogenesis, 6(9), e376-e376 (2017-09-05)
Human chorionic gonadotropin β (β-hCG) has been implicated in breast tumorigenesis. However, the role of this hormone is highly controversial as certain studies suggest it has anti-tumor properties while others have found it to be pro-tumorigenic. To unveil the truth
Seon Min Woo et al.
Oncotarget, 8(63), 106672-106684 (2018-01-02)
Cathepsin G is a serine protease secreted from activated neutrophils, it has important roles in inflammation and immune response. Moreover, cathepsin G promotes tumor cell-cell adhesion and migration in cancer cells. In this study, we investigated whether inhibition of cathepsin
Sudha Saryu Malhotra et al.
Scientific reports, 5, 11210-11210 (2015-06-09)
The aim of the present study is to delineate the role of human chorionic gonadotropin (hCG) in trophoblast fusion. In this direction, using shRNA lentiviral particles, α- and β-hCG silenced 'BeWo' cell lines were generated. Treatment of both α- and

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica