Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU027151

Sigma-Aldrich

MISSION® esiRNA

targeting human CHRM3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GCTCCTCCTGGATACACAGCCCCTCCGATGCAGGGCTGCCCCCGGGAACCGTCACTCATTTCGGCAGCTACAATGTTTCTCGAGCAGCTGGCAATTTCTCCTCTCCAGACGGTACCACCGATGACCCTCTGGGAGGTCATACCGTCTGGCAAGTGGTCTTCATCGCTTTCTTAACGGGCATCCTGGCCTTGGTGACCATCATCGGCAACATCCTGGTAATTGTGTCATTTAAGGTCAACAAGCAGCTGAAGACGGTCAACAACTACTTCCTCTTAAGCCTGGCCTGTGCCGATCTGATTATCGGGGTCATTTCAATGAATCTGTTTACGACCTACATCATCATGAATCGATGGGCCTTAGGGAACTTGGCCTGTGACCTCTGGCTTGCCATTGACTACGTAGCCAGCAATGCCTCTGT

Ensembl | Número de adesão de ser humano

ENSG00000133019

nº de adesão NCBI

NM_000740

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CHRM3(1131) , CHRM3(1131)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
QCS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Lulu Farhana et al.
Stem cell research & therapy, 7(1), 181-181 (2016-12-03)
Although the unconjugated secondary bile acids, specifically deoxycholic acid (DCA) and lithocholic acid (LCA), are considered to be risk factors for colorectal cancer, the precise mechanism(s) by which they regulate carcinogenesis is poorly understood. We hypothesize that the cytotoxic bile
Huangfei Yu et al.
Scientific reports, 7, 40802-40802 (2017-01-20)
Acetylcholine (ACh), known as a neurotransmitter, regulates the functions of numerous fundamental central and peripheral nervous system. Recently, emerging evidences indicate that ACh also plays an important role in tumorigenesis. However, little is known about the role of ACh in
Zhenhua Shang et al.
Neurourology and urodynamics, 38(2), 615-624 (2018-12-15)
To investigate the effects of injecting RNA interference (RNAi) lentiviruses targeting the muscarinic 3 (M3 ) receptor gene into the bladder wall on bladder activity in rats with spinal cord injury (SCI). Four M3 RNAi lentiviruses were constructed and used
Mahmoud Mona et al.
International journal of molecular sciences, 20(3) (2019-02-15)
Sjögren's syndrome (SjS) is an autoimmune disease that destroys the salivary glands and results in severe dry mouth. Mesenchymal stem cell (MSC) transplantation has been recently proposed as a promising therapy for restoring cells in multiple degenerative diseases. We have
Fenglin Sun et al.
Phytotherapy research : PTR, 33(5), 1551-1561 (2019-05-09)
Aacacetin, a plant flavone has shown antitumor efficacy recently. However, its associated mechanisms are poorly known. We hypothesized that the muscarinic M3 receptor (M3 R), which is highly expressed in some cancer tissue, is related to the antitumor effect of
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica