Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU027141

Sigma-Aldrich

MISSION® esiRNA

targeting human PTN

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Check Cart for Availability
Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Check Cart for Availability

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GAGTGCAAGCAAACCATGAAGACCCAGAGATGTAAGATCCCCTGCAACTGGAAGAAGCAATTTGGCGCGGAGTGCAAATACCAGTTCCAGGCCTGGGGAGAATGTGACCTGAACACAGCCCTGAAGACCAGAACTGGAAGTCTGAAGCGAGCCCTGCACAATGCCGAATGCCAGAAGACTGTCACCATCTCCAAGCCCTGTGGCAAACTGACCAAGCCCAAACCTCAAGCAGAATCTAAGAAGAAGAAAAAGGAAGGCAAGAAACAGGAGAAGATGCTGGATTAAAAGATGTCACCTGTGGAACATAAAAAGGACATCAGCAAACAGGATCAGTTAACTATTGCATTTATATGTACCGTAGGCTTTGTATTCAAAAATTATCTATAGCTAAGTACACAATAAGCAAAAACAAAAAGAAAAGAAAATTTTTGTAGTAGCGTTTTTTAAATGTATACTATAGTACCAGTAGGGGCTTATAATAAAGGA

Ensembl | Número de adesão de ser humano

ENSG00000105894

nº de adesão NCBI

NM_002825

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PTN(5764) , PTN(5764)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
HVR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Biqiang Zhu et al.
Cancer medicine, 9(2), 783-796 (2020-01-21)
Cholangiocarcinoma is a malignant tumor originating from bile duct epithelium. Currently, the treatment strategy is very limited and the prognosis is poor. Recent studies reported celastrol exhibits antigrowth and antimetastasis properties in many tumors. Our study aimed to assess the
Xingxing Sun et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 128, 110201-110201 (2020-05-28)
Opa-interacting protein 5 antisense RNA1 (OIP5-AS1) has been demonstrated to facilitate proliferation, metastasis and resistance to treatments in various types of cancers. Nevertheless, the exact mechanisms underlying the roles of OIP5-AS1 in osteosarcoma(OS) drug resistance have not yet been clearly
Xue Ding et al.
Graefe's archive for clinical and experimental ophthalmology = Albrecht von Graefes Archiv fur klinische und experimentelle Ophthalmologie, 255(5), 873-884 (2017-01-14)
The purpose of our study was to investigate the effects of pleiotrophin (PTN) in proliferative vitreoretinopathy (PVR) both in vitro and in vivo. Immunofluorescence was used to observe the PTN expression in periretinal membrane samples from patients with PVR and

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica