Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU023381

Sigma-Aldrich

MISSION® esiRNA

targeting human FFAR2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GCCTGGTGCTCTTCTTCATCCCCATGGCAGTCACCATCTTCTGCTACTGGCGTTTTGTGTGGATCATGCTCTCCCAGCCCCTTGTGGGGGCCCAGAGGCGGCGCCGAGCCGTGGGGCTGGCTGTGGTGACGCTGCTCAATTTCCTGGTGTGCTTCGGACCTTACAACGTGTCCCACCTGGTGGGGTATCACCAGAGAAAAAGCCCCTGGTGGCGGTCAATAGCCGTGGTGTTCAGTTCACTCAACGCCAGTCTGGACCCCCTGCTCTTCTATTTCTCTTCTTCAGTGGTGCGCAGGGCATTTGGGAGAGGGCTGCAGGTGCTGCGGAATCAGGGCTCCTCCCTGTTGGGACGCAGAGGCAAAGACACAGCAGAGGGGACAAATGAGGACAGGGGTGTGGGTCAAGGAGAAGGGATGCCAAGT

Ensembl | Número de adesão de ser humano

ENSG00000126262

nº de adesão NCBI

NM_005306

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... FFAR2(2867) , FFAR2(2867)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Laure B Bindels et al.
British journal of cancer, 117(9), 1336-1340 (2017-09-06)
Activation of free fatty acid receptor 2 (FFAR2) by microbiota-derived metabolites (e.g., propionate) reduces leukaemic cell proliferation in vitro. This study aims to test whether Ffar2 expression per se also influences leukaemia cell growth in vivo. Bcr-Abl-expressing BaF cells were
Rebecca Roy et al.
Journal of molecular endocrinology, 65(2), 21-34 (2020-06-25)
Gestational diabetes mellitus (GDM) affects up to 16% of pregnant women and is associated with significant long-term health detriments for the mother and her offspring. Two central features of GDM are low-grade inflammation and maternal peripheral insulin resistance, therefore therapeutics
Hiroki Yoshida et al.
Archives of biochemistry and biophysics, 672, 108057-108057 (2019-07-30)
Short-chain fatty acids (SCFAs) such as acetate, propionate, and butyrate are generated by gut microbial fermentation of dietary fiber. SCFAs may exert multiple beneficial effects on human lipid and glucose metabolism. However, their actions and underlying mechanisms are not fully
Guangwen Wang et al.
Journal of virology, 94(2) (2019-11-07)
Influenza A virus (IAV) coopts numerous host factors to complete its replication cycle. Here, we identify free fatty acid receptor 2 (FFAR2) as a cofactor for IAV entry into host cells. We found that downregulation of FFAR2 or Ffar2 expression

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica