Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU018671

Sigma-Aldrich

MISSION® esiRNA

targeting human SMAD4

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Check Cart for Availability
Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Check Cart for Availability

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TGTGCCATAGACAAGGTGGAGAGAGTGAAACATTTGCAAAAAGAGCAATTGAAAGTTTGGTAAAGAAGCTGAAGGAGAAAAAAGATGAATTGGATTCTTTAATAACAGCTATAACTACAAATGGAGCTCATCCTAGTAAATGTGTTACCATACAGAGAACATTGGATGGGAGGCTTCAGGTGGCTGGTCGGAAAGGATTTCCTCATGTGATCTATGCCCGTCTCTGGAGGTGGCCTGATCTTCACAAAAATGAACTAAAACATGTTAAATATTGTCAGTATGCGTTTGACTTAAAATGTGATAGTGTCTGTGTGAATCCATATCACTACGAACGAGTTGTATCACCTGGAATTGATCTCTCAGGATTAACACTGCAGAGTAATGCTCCATCAAGTATGATGGTGAAGGATGAATATGTGCATGACTTTGAGGGACAGCCATCGTTGTCCACTGAAGGACATTCAATTCAAACCATCCAGCATCCACCAAGTAATCGTGCATCG

Ensembl | Número de adesão de ser humano

ENSG00000141646

nº de adesão NCBI

NM_005359

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SMAD4(4089) , SMAD4(4089)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

12 - Non Combustible Liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
FDV
PCV
YBV
MOU
RNU

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Mao Ding et al.
Journal of experimental & clinical cancer research : CR, 39(1), 28-28 (2020-02-06)
Sirtuin-7 (SIRT7) is associated with the maintenance of tumorigenesis. However, its functional roles and oncogenic mechanisms in prostate cancer (PCa) are poorly understood. Here, we investigated the roles and underlying molecular mechanisms of SIRT7 in PCa cell growth and androgen-induced
Ryotaro Ogawa et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 25(9), 2887-2899 (2019-02-02)
SMAD4 is a key transcriptional factor of TGFβ signaling and acts as a tumor suppressor in colorectal cancer. In the present study, we explored the immunologic effect of SMAD4 on the tumor microenvironment. Using 99 clinical specimens and human colorectal
Xiaojiang Tang et al.
Journal of cellular biochemistry, 121(11), 4642-4653 (2020-02-13)
As an aggressive breast cancer (BCa) subtype, triple-negative breast cancer (TNBC) responses poorly to chemotherapy and endocrine therapy, and usually has a worse prognosis. This is largely due to the lack of specific therapeutic targets, laying claim to an imperious
Danyang Chao et al.
Biochemical and biophysical research communications, 509(2), 535-540 (2019-01-02)
AZD3759 is a tyrosine kinase inhibitor and has an encouraging future in treating brain metastases of non-small cell lung cancer. Here, we determined that AZD3759 suppressed the viability of HepG2 cells, a hepatoma cell line, and induced their apoptosis, suggesting
Ri Youn Kim et al.
Tissue engineering. Part A, 21(13-14), 2076-2088 (2015-04-04)
Clinical data show that estrogen levels are inversely associated with the production of sclerostin, a Wnt antagonist that recently attracted great attention over the use of its antibody in the anabolic treatment of osteoporotic conditions. However, the molecular link between
Exibir todos os documentos relacionados

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica