Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU016411

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPKAPK5 (2)

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51
Preço e disponibilidade não estão disponíveis no momento.

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GCTGGGAGCTGGAATTAGTGGTCCAGTTAGAGTCTGTGTAAAGAAATCTACTCAAGAACGGTTTGCGCTGAAAATTCTTCTTGATCGTCCAAAAGCTAGAAATGAGGTACGTCTGCACATGATGTGTGCCACACACCCAAACATAGTTCAGATTATTGAAGTGTTTGCTAACAGTGTCCAGTTTCCCCATGAGTCCAGCCCTAGGGCCCGACTCTTAATTGTAATGGAGATGATGGAAGGGGGAGAGCTATTTCACAGAATCAGCCAGCACCGGCACTTTACAGAGAAGCAAGCCAGCCAAGTAACAAAGCAGGCAACTTTGGCTCTGCGGCACTGTCACTTGTTAAACATTGCGCACAGAGACCTCAAGCCTGAAAATCTGCTTTTTAAGGATAACTCTTTGGATGCCCCAGTGAAGTTGTGTGACTTTGGATTTGCCAAGATTGACCAAGGTGACTTGATGACACCCCAGTTCACCCCTTATTATGTAGCACCCCAGGTACTGGA

Ensembl | Número de adesão de ser humano

ENSG00000089022

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... MAPKAPK5(8550) , MAPKAPK5(8550)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
JUU
EXR
RPR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Sherin Ali Nawaito et al.
American journal of physiology. Heart and circulatory physiology, 316(6), H1281-H1296 (2019-03-23)
MK5 is a protein serine/threonine kinase activated by p38, ERK3, and ERK4 MAPKs. MK5 mRNA and immunoreactivity are detected in mouse cardiac fibroblasts, and MK5 haplodeficiency attenuates the increase in collagen 1-α1 mRNA evoked by pressure overload. The present study
Yoonhee Kim et al.
Molecular neurodegeneration, 11, 4-4 (2016-01-14)
The receptor for advanced glycation end products (RAGE) has been found to interact with amyloid β (Aβ). Although RAGE does not have any kinase motifs in its cytosolic domain, the interaction between RAGE and Aβ triggers multiple cellular signaling involved
Natalia Ronkina et al.
PloS one, 10(8), e0136138-e0136138 (2015-08-22)
MK5 (MAPK-activated protein kinase 5) or PRAK (p38-regulated and -activated kinase) are alternative names for a serine/threonine protein kinase downstream to ERK3/4 and p38 MAPK. A previous gene targeting approach for MK5/PRAK (termed here MK5/PRAK-Δex8) revealed a seemingly tumor-suppressive role
Katarzyna Bogucka et al.
eLife, 9 (2020-04-22)
ERK3 is a ubiquitously expressed member of the atypical mitogen activated protein kinases (MAPKs) and the physiological significance of its short half-life remains unclear. By employing gastrointestinal 3D organoids, we detect that ERK3 protein levels steadily decrease during epithelial differentiation.

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica