Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU015511

Sigma-Aldrich

MISSION® esiRNA

targeting human PLG

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GTTCCACTTCTCCCCACAGACCTAGATTCTCACCTGCTACACACCCCTCAGAGGGACTGGAGGAGAACTACTGCAGGAATCCAGACAACGATCCGCAGGGGCCCTGGTGCTATACTACTGATCCAGAAAAGAGATATGACTACTGCGACATTCTTGAGTGTGAAGAGGAATGTATGCATTGCAGTGGAGAAAACTATGACGGCAAAATTTCCAAGACCATGTCTGGACTGGAATGCCAGGCCTGGGACTCTCAGAGCCCACACGCTCATGGATACATTCCTTCCAAATTTCCAAACAAGAACCTGAAGAAGAATTACTGTCGTAACCCCGATAGGGAGCTGCGGCCTTGGTGTTTCACCACCGACCCCAACAAGCGCTGGGAACTTTGTGACATCCCCCGCTGCACAACACCTCCACCATCTTCTGG

Ensembl | Número de adesão de ser humano

ENSG00000122194

nº de adesão NCBI

NM_000301

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PLG(5340) , PLG(5340)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Lan-Zhi Wang et al.
Developmental and comparative immunology, 106, 103598-103598 (2019-12-28)
Interleukin 18 (IL-18), a member of IL-1 cytokine superfamily, is an important proinflammatory cytokine with multiple functions in both innate immunity and acquired immunity. However, the characteristics and functional roles of IL-18 remain largely unknown in amphibians, which were classed
Uttam Satyal et al.
ACS applied materials & interfaces, 9(35), 29481-29495 (2017-08-16)
This article presents the synthesis, self-assembly, and biological activity as transfection agents for pDNA, siRNA, and mRNA of novel pyridinium pseudogemini surfactants, interfacially engineered from the most efficient gemini surfactants and lipids generated in our amphiphile research program. Formulation of
Liuping Wei et al.
Cellular signalling, 26(7), 1476-1488 (2014-03-25)
We have established that 15-hydroxyeicosatetraenoic acid is an important factor in regulation of pulmonary vascular remodeling (PVR) associated with hypoxia-induced pulmonary hypertension (PH), which is further metabolized by 15-hydroxyprostaglandin dehydrogenase (15-PGDH) to form 15-ketoeicosatetraenoic acid (15-KETE). However, the role of
Karen A Newell-Litwa et al.
The Journal of cell biology, 210(2), 225-242 (2015-07-15)
RhoGTPases organize the actin cytoskeleton to generate diverse polarities, from front-back polarity in migrating cells to dendritic spine morphology in neurons. For example, RhoA through its effector kinase, RhoA kinase (ROCK), activates myosin II to form actomyosin filament bundles and

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica