Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU011701

Sigma-Aldrich

MISSION® esiRNA

targeting human CARTPT

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ACGAGAAGGAGCTGATCGAAGCGCTGCAAGAAGTCTTGAAGAAGCTCAAGAGTAAACGTGTTCCCATCTATGAGAAGAAGTATGGCCAAGTCCCCATGTGTGACGCCGGTGAGCAGTGTGCAGTGAGGAAAGGGGCAAGGATCGGGAAGCTGTGTGACTGTCCCCGAGGAACCTCCTGCAATTCCTTCCTCCTGAAGTGCTTATGAAGGGGCGTCCATTCTCCTCCATACATCCCCATCCCTCTACTTTCCCCAGAGGACCACACCTTCCTCCCTGGAGTTTGGCTTAAGCAACAGATAAAGTTTTTATTTTCCTCTGAAGGGAAAGGGCTCTTTTCCTGCTGTTTCAAAAATAAAAGAACACATTAGATGTTACTGTGTGAAGAATAATGCCTTGTATGGTGTTGATACGTGTGTGAAGTATTCTTATTTTATTTGTCTGACAAACTCTTGTGTACCTTTGTGTAAAGAAGGGAAGCTTTGTTTGAAAATTGTATTTTTGTATGTGGCATGGCAGAAT

Ensembl | Número de adesão de ser humano

ENSG00000164326

nº de adesão NCBI

NM_004291

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CARTPT(9607) , CARTPT(9607)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

L Shcherbina et al.
Molecular and cellular endocrinology, 447, 52-60 (2017-02-27)
Impaired beta-cell function is key to the development of type 2 diabetes. Cocaine- and amphetamine-regulated transcript (CART) is an islet peptide with insulinotropic and glucagonostatic properties. Here we studied the role of endogenous CART in beta-cell function. CART silencing in
Ji-Yao Li et al.
Journal of neurophysiology, 121(3), 928-939 (2019-01-17)
Hyperphagia is common in diabetes and may worsen hyperglycemia and diabetic complications. The responsible mechanisms are not well understood. The hypothalamus is a key center for the control of appetite and energy homeostasis. The ventromedial nucleus (VMH) and arcuate nucleus
Shin J Lee et al.
Cell reports, 30(6), 2028-2039 (2020-02-13)
The vagus nerve conveys gastrointestinal cues to the brain to control eating behavior. In obesity, vagally mediated gut-brain signaling is disrupted. Here, we show that the cocaine- and amphetamine-regulated transcript (CART) is a neuropeptide synthesized proportional to the food consumed

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica