Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU009931

Sigma-Aldrich

MISSION® esiRNA

targeting human BAMBI

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Check Cart for Availability
Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Check Cart for Availability

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CCAAAGGTGAAATTCGATGCTACTGTGATGCTGCCCACTGTGTAGCCACTGGTTATATGTGTAAATCTGAGCTCAGCGCCTGCTTCTCTAGACTTCTTGATCCTCAGAACTCAAATTCCCCACTCACCCATGGCTGCCTGGACTCTCTTGCAAGCACGACAGACATCTGCCAAGCCAAACAGGCCCGAAACCACTCTGGCACCACCATACCCACATTGGAATGCTGTCATGAAGACATGTGCAATTACAGAGGGCTGCACGATGTTCTCTCTCCTCCCAGGGGTGAGGCCTCAGGACAAGGAAACAGGTATCAGCATGATGGTAGCAGAAACCTTATCACCAAGGTGCAGGAGCTGACTTCTTCCAAAGAGTTGTGGTTCCGGGCAGCGGTCATTGCCGTGCCCATTGCTGGAGGGCTGATTTTAGTGTTGCTTATTATGTTGGCCCTGAGGATGCTTCGAAGTGAAAATAAGAGGCTGCAGGATCAGCGGCAACAGATGCTCTCCCGTTTGCACTACAGCTTTCACGG

Ensembl | Número de adesão de ser humano

ENSG00000095739

nº de adesão NCBI

NM_012342

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... BAMBI(25805) , BAMBI(25805)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
OAV
NZU
QCS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Longbiao Yang et al.
Molecular medicine reports, 20(4), 3901-3909 (2019-09-06)
To investigate the role of microRNA (miR)‑519d‑3p in postoperative epidural scar formation and its regulation of the bone morphogenetic protein and activin membrane‑bound inhibitor (BAMBI), miR‑519d‑3p and BAMBI expression levels in the lumbar disc of patients who had undergone laminectomy
Zhao Wang et al.
OncoTargets and therapy, 13, 131-142 (2020-02-06)
Non-small cell lung cancer (NSCLC) is a common malignancy over the world. Previous report indicated that the plasmacytoma variant translocation 1 (PVT1) has been documented to function as an oncogene in various types of human cancers. However, the biological mechanism
Jingjing He et al.
Growth factors (Chur, Switzerland), 34(5-6), 210-216 (2017-02-18)
Fibroblast growth factor-1 (FGF-1) promotes differentiation of human preadipocytes into mature adipocytes via modulation of a BMP and Activin Membrane-Bound Inhibitor (BAMBI)/Peroxisome proliferator-activated receptor (PPARγ)-dependent network. Here, we combined transcriptomic and functional investigations to identify novel downstream effectors aligned with
Long Bai et al.
Cellular signalling, 37, 52-61 (2017-06-05)
Bone morphogenetic protein and activin membrane-bound inhibitor (BAMBI) is a transforming growth factor β (TGF-β) type I receptor antagonist that negatively regulates TGF-β and bone morphogenetic protein (BMP) signaling. BAMBI has been shown to be regulated by TGF-β signaling; however
Christopher Grunseich et al.
Molecular cell, 69(3), 426-437 (2018-02-06)
R-loops are three-stranded nucleic acid structures found abundantly and yet often viewed as by-products of transcription. Studying cells from patients with a motor neuron disease (amyotrophic lateral sclerosis 4 [ALS4]) caused by a mutation in senataxin, we uncovered how R-loops

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica