Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU009491

Sigma-Aldrich

MISSION® esiRNA

targeting human ZC3H12A

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CACAGTGTTTGTGCCATCCTGGAGGAAGGAGCAGCCTCGGCCCGACGTGCCCATCACAGACCAGCACATCCTGCGGGAACTGGAGAAGAAGAAGATCCTGGTGTTCACACCATCACGACGCGTGGGTGGCAAGCGGGTGGTGTGCTATGACGACAGATTCATTGTGAAGCTGGCCTACGAGTCTGACGGGATCGTGGTTTCCAACGACACATACCGTGACCTCCAAGGCGAGCGGCAGGAGTGGAAGCGCTTCATCGAGGAGCGGCTGCTCATGTACTCCTTCGTCAATGACAAGTTTATGCCCCCTGATGACCCACTGGGCCGGCACGGGCCCAGCCTGGACAACTTCCTGCGTAAGAAGCCACTCACTTTGGAGCACAGGAAGCAGCCGTGTCCCTATGGAAGGAAATGCACCTATGGGATCAAGTGCCGAT

Ensembl | Número de adesão de ser humano

ENSG00000163874

nº de adesão NCBI

NM_025079

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ZC3H12A(80149) , ZC3H12A(80149)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

12 - Non Combustible Liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
ZRU
PRU
HRX
HXR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Zhuqing Jin et al.
International journal of molecular sciences, 20(1) (2019-01-10)
MCP-1-induced protein (MCPIP, also known as Zc3h12a or Regnase-1), a newly identified suppressor of cytokine signaling, is expressed in endothelial cells (ECs). To investigate the role of endothelial MCPIP in vascular homeostasis and function, we deleted the MCPIP gene specifically
Min Li et al.
Medical microbiology and immunology, 207(1), 27-38 (2017-10-19)
Monocyte chemotactic protein-induced protein 1(MCPIP1) is identified as an important inflammatory regulator during immune response. MCPIP1 possesses antiviral activities against several viruses, such as Japanese encephalitis. However, its role on Coxsackievirus B3 (CVB3) infection, a positive-stranded RNA virus, has not
You-Take Oh et al.
Oncogene, 37(25), 3415-3425 (2018-03-20)
Monocyte chemotactic protein-induced protein-1 (MCPIP1; also called Regnase-1) encoded by the ZC3H12A gene critically regulates inflammatory responses and immune homeostasis primarily by RNase-dependent and -independent mechanisms. However, the relationship of MCPIP1 with apoptosis and cancer and the underlying mechanisms are
Nidhi Kapoor et al.
Journal of immunology (Baltimore, Md. : 1950), 194(12), 6011-6023 (2015-05-03)
Macrophage polarization plays a critical role in tissue homeostasis, disease pathogenesis, and inflammation and its resolution. IL-4-induced macrophage polarization involves induction of STAT6 and Krüppel-like factor 4 (KLF4), which induce each other and promote M2 polarization. However, how these transcription

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica