Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU006581

Sigma-Aldrich

MISSION® esiRNA

targeting human SUFU

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGCTTTGAGTTGACCTTTCGTCTGAAGAGAGAAACTGGGGAGTCTGCCCCACCAACATGGCCCGCAGAGTTAATGCAGGGCTTGGCACGATACGTGTTCCAGTCAGAGAACACCTTCTGCAGTGGGGACCATGTGTCCTGGCACAGCCCTTTGGATAACAGTGAGTCAAGAATTCAGCACATGCTGCTGACAGAGGACCCACAGATGCAGCCCGTGCAGACACCCTTTGGGGTAGTTACCTTCCTCCAGATCGTTGGTGTCTGCACTGAAGAGCTACACTCAGCCCAGCAGTGGAACGGGCAGGGCATCCTGGAGCTGCTGCGGACAGTGCCTATTGCTGGCGGCCCCTGGCTGATAACTGACATGCGGAGGGGAGAGACCATATTTGAGATCGATCCACACCTGCAAGAGAGAGTTGACAAAGGCATCGAGACAG

Ensembl | Número de adesão de ser humano

ENSG00000107882

nº de adesão NCBI

NM_016169

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SUFU(51684) , SUFU(51684)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
LSS
JRR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yin Peng et al.
Cell cycle (Georgetown, Tex.), 19(20), 2720-2733 (2020-10-06)
The poor prognosis of late gastric carcinomas (GC) underscores the necessity to identify novel biomarkers for earlier diagnosis and effective therapeutic targets. MiRNA-324-5p has been shown to be over-expressed in GC, however the biological function of miRNA-324-5p implicated in gastric
Yin Peng et al.
Cancer letters, 385, 117-127 (2016-11-05)
Emerging evidence has shown that miRNA-194 is aberrantly upregulated in gastric cancer (GC); however, the biological mechanisms underlying its involvement are largely unknown. Wnt/β-catenin signaling has been implicated in gastric tumorigenesis; we therefore hypothesized that miRNA-194 promotes gastric carcinogenesis by
Bo Ram Kim et al.
Cell death and differentiation, 27(2), 676-694 (2019-07-07)
Disabled tumor suppressor genes and hyperactive oncogenes greatly contribute to cell fates during cancer development because of their genetic alterations such as somatic mutations. However, little is known about how tumor suppressor genes react to diverse oncogenes during tumor progression.

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica