Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU005681

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CATGAACTCGGCCATTCTCTTGGACTCTCCCATTCTACTGATATCGGGGCTTTGATGTACCCTAGCTACACCTTCAGTGGTGATGTTCAGCTAGCTCAGGATGACATTGATGGCATCCAAGCCATATATGGACGTTCCCAAAATCCTGTCCAGCCCATCGGCCCACAAACCCCAAAAGCGTGTGACAGTAAGCTAACCTTTGATGCTATAACTACGATTCGGGGAGAAGTGATGTTCTTTAAAGACAGATTCTACATGCGCACAAATCCCTTCTACCCGGAAGTTGAGCTCAATTTCATTTCTGTTTTCTGGCCACAACTGCCAAATGGGCTTGAAGCTGCTTACGAATTTGCCGACAGAGATGAAGTCCGGTTTTTCAAAGGGAATAAGTACTGGGCTGTTCAGGGACAGAATGTGCTACACGGATACCCCAAGGA

Ensembl | Número de adesão de ser humano

ENSG00000196611

nº de adesão NCBI

NM_002421

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... MMP1(4312) , MMP1(4312)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Shuichi Shimada et al.
Journal of dermatological science, 100(3), 183-191 (2020-10-16)
Systemic sclerosis (SSc) is characterized by excessive deposition of collagen in the skin and internal organs. Recent studies have shown that chemokine (C-X-C motif) ligands (CXCLs) are involved in the pathogenesis of SSc. Our aim was to examine the anti-fibrotic
Ching-Ju Shen et al.
PloS one, 12(3), e0174487-e0174487 (2017-03-24)
High matrix metalloproteinase 1 (MMP1) expression is associated with enhanced breast cancer growth and metastasis and also might predict poor prognosis. In this study, we further investigated the functional role of MMP1 and how it is upregulated in multi-drug resistant
Elisa Roztocil et al.
Scientific reports, 10(1), 8477-8477 (2020-05-23)
Thyroid eye disease (TED) affects 25-50% of patients with Graves' Disease. In TED, collagen accumulation leads to an expansion of the extracellular matrix (ECM) which causes destructive tissue remodeling. The purpose of this study was to investigate the therapeutic potential
Rania Harati et al.
PloS one, 15(10), e0239292-e0239292 (2020-10-02)
Brain metastasis (BM) is a major cause of morbidity and mortality in breast cancer (BC) and its molecular mechanism remains poorly understood. Transmigration of metastatic cells through the brain endothelium is an essential step in BM. Metalloproteinase-1 (MMP-1) overexpression plays

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica