Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

View All Documentation

EHU004761

Sigma-Aldrich

MISSION® esiRNA

targeting human CYP27B1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GGAAATTCTCGTGTCCCAGACAAAGACATTCATGTGGGTGACTATATTATCCCCAAAAATACGCTGGTCACTCTGTGTCACTATGCCACTTCAAGGGACCCTGCCCAGTTCCCAGAGCCAAATTCTTTTCGTCCAGCTCGCTGGCTGGGGGAGGGTCCCACCCCCCACCCATTTGCATCTCTTCCCTTTGGCTTTGGCAAGCGCAGCTGTATGGGGAGACGCCTGGCAGAGCTTGAATTGCAAATGGCTTTGGCCCAGATCCTAACACATTTTGAGGTGCAGCCTGAGCCAGGTGCGGCCCCAGTTAGACCCAAGACCCGGACTGTCCTGGTACCTGAAAGGAGCATCAACCTACAGTTTTTGGACAGATAGTCCCATGGAAAGAGACTGTCATCATCACCCTTTCATTCATCATAGGGATAAGATTTTTTGTAGGCACAAGACCAAGGTATACATCTTCCCCTAATGCCTATCTGACCAAACTGGATAGAACCACCATAGTGAAGTGTGAGGCGGCCCTGACCAATGTGTGAAGTATGCACTTGGCCTG

Ensembl | Número de adesão de ser humano

ENSG00000111012

nº de adesão NCBI

NM_000785

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CYP27B1(1594) , CYP27B1(1594)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Hana Sustova et al.
Acta physiologica (Oxford, England), 226(3), e13269-e13269 (2019-03-06)
Loss of skeletal muscle is one of the main features of cancer cachexia. Vitamin D (VD) deficiency is associated with impairment of muscle mass and performance and is highly prevalent in cachectic patients; therefore, VD supplementation has been proposed to
Shuo Geng et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 26(5), 1145-1153 (2011-05-05)
1,25-Dihydroxyvitamin D(3)[1,25(OH)(2)D(3)] has many noncalcemic actions that rest on inhibition of proliferation and promotion of differentiation in malignant and normal cell types. 1,25(OH)(2)D(3) stimulates osteoblast differentiation of human marrow stromal cells (hMSCs), but little is known about the effects of
Kaining Liu et al.
PloS one, 7(6), e39878-e39878 (2012-07-05)
We previously demonstrated that 25-hydroxyvitamin D(3), the precursor of 1α,25-dihydroxyvitamin D(3), is abundant around periodontal soft tissues. Here we investigate whether 25-hydroxyvitamin D(3) is converted to 1α,25-dihydroxyvitamin D(3) in periodontal soft tissue cells and explore the possibility of an autocrine/paracrine
Ken-ichiro Tanaka et al.
Biochemical and biophysical research communications, 450(1), 482-487 (2014-06-14)
Vitamin D deficiency and advanced glycation end products (AGEs) are suggested to be involved in the pathogenesis of osteoporosis and sarcopenia. However, the effects of vitamin D and AGEs on myogenesis and the interaction between muscle and bone remains still
Lars Brodowski et al.
PloS one, 9(6), e98527-e98527 (2014-06-03)
Placenta-derived circulating factors contribute to the maternal endothelial dysfunction underlying preeclampsia. Endothelial colony forming cells (ECFC), a sub-population of endothelial progenitor cells (EPCs), are thought to be involved in vasculogenesis and endothelial repair. Low vitamin D concentrations are associated with
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica