Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

View All Documentation

EHU003851

Sigma-Aldrich

MISSION® esiRNA

targeting human SAMHD1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ACGCATGAACAAGGCTCAGTTATGATGTTTGAGCACCTTATTAATTCTAATGGAATTAAGCCTGTCATGGAACAATATGGTCTCATCCCTGAAGAAGATATTTGCTTTATAAAGGAACAAATTGTAGGACCACTTGAATCACCTGTCGAAGATTCATTGTGGCCATATAAAGGGCGTCCTGAAAACAAAAGCTTCCTTTATGAGATAGTATCTAATAAAAGAAATGGCATTGATGTGGACAAATGGGATTATTTTGCCAGGGACTGCCATCATCTTGGAATCCAAAATAATTTTGATTACAAGCGCTTTATTAAGTTTGCCCGTGTCTGTGAAGTAGACAATGAGTTGCGTATTTGTGCTAGAGATAAGGAAGTTGGAAATCTGTATGACATGTTCCACACTCGCAACTCTTTACACCGTAGAGCTTATCAACACAAAGTTGGCAACATTATTGATACAATGATTACAGATGCTTTCCTCAAAGCAGATGACTACATAGAGATTACAGGTGCTGGAGGAAAAAAGTATCGCATTTCTACAGCAATTGACGACATGGA

Ensembl | Número de adesão de ser humano

ENSG00000101347

nº de adesão NCBI

NM_015474

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SAMHD1(25939) , SAMHD1(25939)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Weihui Fu et al.
Scientific reports, 6, 38162-38162 (2016-12-07)
SAMHD1 restricts human immunodeficiency virus type 1 (HIV-1) replication in myeloid cells and CD4+ T cells, while Vpx can mediate SAMHD1 degradation to promote HIV-1 replication. Although the restriction mechanisms of SAMHD1 have been well-described, SAMHD1 expression and Vpx-mediated SAMHD1
Thomas Oellerich et al.
Nature communications, 10(1), 3475-3475 (2019-08-04)
Hypomethylating agents decitabine and azacytidine are regarded as interchangeable in the treatment of acute myeloid leukemia (AML). However, their mechanisms of action remain incompletely understood, and predictive biomarkers for HMA efficacy are lacking. Here, we show that the bioactive metabolite
Petra Mlcochova et al.
Cell reports, 30(12), 3972-3980 (2020-03-27)
Macrophages exist predominantly in two distinct states, G0 and a G1-like state that is accompanied by phosphorylation of SAMHD1 at T592. Here, we demonstrate that Toll-like receptor 4 (TLR4) activation can potently induce G0 arrest and SAMHD1 antiretroviral activity by
Vera Rocha-Perugini et al.
Nature microbiology, 2(11), 1513-1522 (2017-09-06)
In this study, we report that the tetraspanin CD81 enhances human immunodeficiency virus (HIV)-1 reverse transcription in HIV-1-infected cells. This is enabled by the direct interaction of CD81 with the deoxynucleoside triphosphate phosphohydrolase SAMHD1. This interaction prevents endosomal accumulation and
Simone De Meo et al.
PLoS pathogens, 16(9), e1008855-e1008855 (2020-09-29)
SAMHD1 is a host restriction factor that functions to restrict both retroviruses and DNA viruses, based on its nuclear deoxynucleotide triphosphate (dNTP) hydrolase activity that limits availability of intracellular dNTP pools. In the present study, we demonstrate that SAMHD1 expression
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica