Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU002981

Sigma-Aldrich

MISSION® esiRNA

targeting human KIF3A

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em01 de junho de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em01 de junho de 2025

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGCTGTCAGTGTGGATGAGATGAGGGGAACTATCACTGTACATAAGACTGATTCTTCCAATGAACCTCCAAAGACATTTACTTTTGATACTGTTTTTGGACCAGAGAGTAAACAACTTGATGTTTATAACTTAACTGCAAGACCTATTATTGATTCTGTACTTGAAGGCTACAATGGGACTATTTTTGCATATGGACAAACCGGAACAGGCAAAACTTTTACCATGGAAGGTGTTCGAGCTATTCCTGAACTTAGAGGAATAATTCCCAATTCATTTGCTCACATATTTGGTCATATTGCAAAAGCGGAGGGTGATACAAGATTTTTGGTTCGAGTGTCTTATTTGGAAATATATAATGAAGAAGTTCGTGACCTTTTGGGCAAGGATCAGACACAAAGGTTAGAGGTTAAAGAAAGACCTGATGTGGGAGTTTATATCAAAGATTTATCAGCTTATGTGGTAAATAATGCTGATGATATGGATAGAATTATGACGCTAGGCCACAAAAATCGTTCTGTTGGTGCAACTAATATGAACGAACATAGTTCCCGTTCCCATG

Ensembl | Número de adesão de ser humano

ENSG00000131437

nº de adesão NCBI

NM_007054

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... KIF3A(11127) , KIF3A(11127)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
OVU
NLU
JCU
HIT
IQS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Loren Masterson et al.
Journal of skin cancer, 2014, 596459-596459 (2014-03-19)
Due to the rarity of Merkel cell carcinoma (MCC), prospective clinical trials have not been practical. This study aimed to identify biomarkers with prognostic significance. While sixty-two patients were identified who were treated for MCC at our institution, only seventeen
Anne-Clémence Vion et al.
The Journal of cell biology, 217(5), 1651-1665 (2018-03-04)
Blood flow shapes vascular networks by orchestrating endothelial cell behavior and function. How endothelial cells read and interpret flow-derived signals is poorly understood. Here, we show that endothelial cells in the developing mouse retina form and use luminal primary cilia
Premkumar Vummidi Giridhar et al.
Journal of immunology (Baltimore, Md. : 1950), 197(11), 4228-4239 (2016-11-01)
KIF3A, the gene encoding kinesin family member 3A, is a susceptibility gene locus associated with asthma; however, mechanisms by which KIF3A might influence the pathogenesis of the disorder are unknown. In this study, we deleted the mouse Kif3a gene in
Don-Marc Franchini et al.
Cell reports, 26(1), 94-107 (2019-01-04)
Despite the clinical success of blocking inhibitory immune checkpoint receptors such as programmed cell death-1 (PD-1) in cancer, the mechanisms controlling the expression of these receptors have not been fully elucidated. Here, we identify a post-transcriptional mechanism regulating PD-1 expression

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica