Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU002941

Sigma-Aldrich

MISSION® esiRNA

targeting human SPARC

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em17 de maio de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em17 de maio de 2025

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

ACGGGTACCTCTCCCACACCGAGCTGGCTCCACTGCGTGCTCCCCTCATCCCCATGGAGCATTGCACCACCCGCTTTTTCGAGACCTGTGACCTGGACAATGACAAGTACATCGCCCTGGATGAGTGGGCCGGCTGCTTCGGCATCAAGCAGAAGGATATCGACAAGGATCTTGTGATCTAAATCCACTCCTTCCACAGTACCGGATTCTCTCTTTAACCCTCCCCTTCGTGTTTCCCCCAATGTTTAAAATGTTTGGATGGTTTGTTGTTCTGCCTGGAGACAAGGTGCTAACATAGATTTAAGTGAATACATTAACGGTGCTAAAAATGAAAATTCTAACCCAAGACATGACATTCTTAGCTGTAACTTAACTATTAAGGCCTTTTCCACACGCATTAATAGTCCCATTTTTCTCTTGCCATTTGTAGCTTTGCCCAT

Ensembl | Número de adesão de ser humano

ENSG00000113140

nº de adesão NCBI

NM_003118

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SPARC(6678) , SPARC(6678)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
XJU
WNS
PYR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jing Zhu et al.
Stem cells (Dayton, Ohio), 38(1), 134-145 (2019-10-24)
The purpose of this study was to investigate the effects of secreted protein acidic and rich in cysteine (SPARC) on the maintenance of limbal epithelial stem cell (LESC) stemness and restoration of ocular surface. To determine the suitable concentration of
Jijun Fu et al.
Carcinogenesis, 38(6), 649-660 (2017-05-13)
Oncogene c-Myc is frequently amplified and activated in human cancers. Deregulation of c-Myc protein has been shown to occur in 30% of all human cancers, especially in hematopoietic malignancies. As a transcription factor, c-Myc has been shown to regulate up
Franco Conforti et al.
Cell death discovery, 6, 54-54 (2020-07-09)
Idiopathic pulmonary fibrosis (IPF) is a chronic scarring disease in which aging, environmental exposure(s) and genetic susceptibility have been implicated in disease pathogenesis, however, the causes and mechanisms of the progressive fibrotic cascade are still poorly understood. As epithelial-mesenchymal interactions
Katrina Viloria et al.
Scientific reports, 6, 37839-37839 (2016-11-26)
SPARC is a matricellular protein that is involved in both pancreatic cancer and diabetes. It belongs to a wider family of proteins that share structural and functional similarities. Relatively little is known about this extended family, but evidence of regulatory
Cho Rong Park et al.
Theranostics, 9(24), 7447-7457 (2019-11-07)
Human serum albumin (HSA) is the most abundant plasma protein. The main reason for using HSA as a versatile tool for drug delivery is based on its ability to accumulate in tumors. However, the mechanism of albumin accumulation in tumors
Exibir todos os documentos relacionados

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica