Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU002571

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC16A1

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Check Cart for Availability
Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Check Cart for Availability

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TCCCTTGAGAAAGCTGGAAAATCTGGTGTGAAAAAAGATCTGCATGATGCAAATACAGATCTTATTGGAAGACACCCTAAACAAGAGAAACGATCAGTCTTCCAAACAATTAATCAGTTCCTGGACTTAACCCTATTCACCCACAGAGGCTTTTTGCTATACCTCTCTGGAAATGTGATCATGTTTTTTGGACTCTTTGCACCTTTGGTGTTTCTTAGTAGTTATGGGAAGAGTCAGCATTATTCTAGTGAGAAGTCTGCCTTCCTTCTTTCCATTCTGGCTTTTGTTGACATGGTAGCCCGACCATCTATGGGACTTGTAGCCAACACAAAGCCAATAAGACCTCGAATTCAGTATTTCTTTGCGGCTTCCGTTGTTGCAAATGGAGTGTGTCATATGCTAGCACCTTTATCCACTACCTATGTTGGATTCTGTGTCTATGCGGGATTCTTTGGATTTGCCTTCGGGTGGCTCAGCTCCGTATTGTTTGAAACATTGATGGACCTTGTTGGACCCCAGAGGTTCTCCAGCGCTGTGGGATTGGTGACCATTGTGGAATGCTG

Ensembl | Número de adesão de ser humano

ENSG00000155380

nº de adesão NCBI

NM_003051

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SLC16A1(6566) , SLC16A1(6566)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
TYU

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

C J De Saedeleer et al.
Oncogene, 33(31), 4060-4068 (2013-10-30)
The glycolytic end-product lactate is a pleiotropic tumor growth-promoting factor. Its activities primarily depend on its uptake, a process facilitated by the lactate-proton symporter monocarboxylate transporter 1 (MCT1). Therefore, targeting the transporter or its chaperon protein CD147/basigin, itself involved in
Jae Hoon Jeong et al.
Scientific reports, 8(1), 6672-6672 (2018-04-29)
Release of fatty acids from lipid droplets upon activation of the sympathetic nervous system (SNS) is a key step in nonshivering thermogenesis in brown adipose tissue (BAT). However, intracellular lipolysis appears not to be critical for cold-induced thermogenesis. As activation
Chunxiao Yan et al.
International journal of clinical and experimental pathology, 8(3), 2710-2718 (2015-06-06)
This study was designed to investigate the role of MCT1 in the development of cisplatin-resistant ovarian cancer and its possible relationship with Fas. We found the expression of MCT1 was obviously increased both in cisplatin-resistant ovarian cancer tissue and A2780/CP

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica