Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU001471

Sigma-Aldrich

MISSION® esiRNA

targeting human AURKB

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ATCTTAACGCGGCACTTCACAATTGATGACTTTGAGATTGGGCGTCCTCTGGGCAAAGGCAAGTTTGGAAACGTGTACTTGGCTCGGGAGAAGAAAAGCCATTTCATCGTGGCGCTCAAGGTCCTCTTCAAGTCCCAGATAGAGAAGGAGGGCGTGGAGCATCAGCTGCGCAGAGAGATCGAAATCCAGGCCCACCTGCACCATCCCAACATCCTGCGTCTCTACAACTATTTTTATGACCGGAGGAGGATCTACTTGATTCTAGAGTATGCCCCCCGCGGGGAGCTCTACAAGGAGCTGCAGAAGAGCTGCACATTTGACGAGCAGCGAACAGCCACGATCATGGAGGAGTTGGCAGATGCTCTAATGTACTGCCATGGGAAGAAGGTGATTCACAGAGACATAAAGCCAGAAAATCTGCTCTTAGGGCTCAAGGGAGAGCTGAAGATTGCTGACTTCGGCTGGTCTGTGCATGCGCCCTCCCTGAGGAGGAAGACAATGTGTGGCACCCTGGACTACCTGCCCCCAGAGATGATTGAGGGGCGCATGCACAATGAGAAGGTGGATCTGTGGTGC

Ensembl | Número de adesão de ser humano

ENSG00000178999

nº de adesão NCBI

NM_004217

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... AURKB(9212) , AURKB(9212)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Sun Lee et al.
Pathology oncology research : POR, 26(1), 453-459 (2018-11-14)
NOP53 ribosome biogenesis factor (NOP53) is a nucleolar protein involved in oncogenesis/tumor suppression, cell cycle regulation, and cell death. Here, we investigated the role of NOP53 in the maintenance of normal nuclear shape and chromosomal stability. Depletion of NOP53 by
Xiaolei Zhang et al.
Annals of translational medicine, 8(10), 646-646 (2020-06-23)
The modification and regulation of N6-methyladenosine (m6A) at mRNA level can affect the development and progression in various tumors. ALKBH5, as an m6A demethylase, plays different roles in tumors by regulating the m6A modification of mRNA. However, its role in
Lin Bao et al.
Journal of Cancer, 11(7), 1712-1726 (2020-03-21)
Purpose: To investigate the potential mechanisms contributing to metastasis of clear cell renal cell carcinoma (ccRCC), screen the hub genes, associated pathways of metastatic ccRCC and identify potential biomarkers. Methods: The ccRCC metastasis gene expression profile GSE47352 was employed to
Yan Guo et al.
American journal of cancer research, 10(10), 3458-3474 (2020-11-10)
Despite significant advances, skin cutaneous melanoma (SKCM) is a common life-threatening cancer worldwide. Recently, pseudogenes have been discovered to be functional in many physiological processes and the pathogenesis of various diseases, including cancer. However, their relevance to SKCM remains largely
Zhibin Yu et al.
Journal of hematology & oncology, 10(1), 115-115 (2017-06-10)
SIX homeobox 3 (SIX3) is a member of the sine oculis homeobox transcription factor family. It plays a vital role in the nervous system development. Our previous study showed that the SIX3 gene is hypermethylated, and its expression is decreased
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica