Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU001181

Sigma-Aldrich

MISSION® esiRNA

targeting human SOCS2

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em01 de maio de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em01 de maio de 2025

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TTCGCACTGACTTCAAGGAAGGACGCGAACCCTTCTCTGACCCCAGCTCGGGCGGCCACCTGTCTTTGCCGCGGTGACCCTTCTCTCATGACCCTGCGGTGCCTTGAGCCCTCCGGGAATGGCGGGGAAGGGACGCGGAGCCAGTGGGGGACCGCGGGGTCGGCGGAGGAGCCATCCCCGCAGGCGGCGCGTCTGGCGAAGGCCCTGCGGGAGCTCGGTCAGACAGGATGGTACTGGGGAAGTATGACTGTTAATGAAGCCAAAGAGAAATTAAAAGAGGCACCAGAAGGAACTTTCTTGATTAGAGATAGCTCGCATTCAGACTACCTACTAACAATATCTGTTAAAACATCAGCTGGACCAACTAATCTTCGAATCGAATACCAAGACGGAAAATTCAGATTGGACTCTATCATATGTGTCAAATCCAAGCTTAAACAATTTGACAGTGTGGTTCATCTGATCGACTACTATGTTCAGATGTGCAAGGATAAGCGGACAGGTCCAGAAGCCCCCCGGAACGGCACTGTTCACCTTTATCTGACCAAACCGCTCTACACGTCAGCACCATCTCTG

Ensembl | Número de adesão de ser humano

ENSG00000120833

nº de adesão NCBI

NM_003877

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SOCS2(8835) , SOCS2(8835)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
XZU
ZYU

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Fang Wang et al.
Journal of biomedical science, 28(1), 4-4 (2021-01-06)
Circular RNAs (circRNAs) have caught increasing attentions and interests for their important involvement in cancer initiation and progression. This study aims to investigate the biological functions of circNOL10 and its potential molecular mechanisms in breast cancer (BC). qRT-PCR and western
Haichun Ouyang et al.
International immunopharmacology, 81, 106204-106204 (2020-02-23)
Accumulating evidence has revealed the roles of microRNAs (miRs) in sepsis, hence, the aim of the present study was to investigate whether miR-208a-5p affects sepsis whilst attempting to elucidate the mechanisms by which the suppressors of cytokine signaling 2 (SOCS2)-mediated
Jihao Xu et al.
Oncology reports, 44(3), 973-986 (2020-07-25)
N6‑methyladenosine (m6A) RNA modification maintained by N6‑methyltransferases and demethylases is involved in multiple biological functions. Methyltransferase like 3 (METTL3) is a major N6‑methyltransferase. However, the role of METTL3 and its installed m6A modification in colorectal tumorigenesis remains to be fully

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica