Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU151861

Sigma-Aldrich

MISSION® esiRNA

targeting human VIM

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
192,00 €
50 μG
341,00 €

192,00 €

Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.
Toutes les photos(1)

Sélectionner une taille de conditionnement

Changer de vue
20 μG
192,00 €
50 μG
341,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

192,00 €

Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCTTGAACGCAAAGTGGAATCTTTGCAAGAAGAGATTGCCTTTTTGAAGAAACTCCACGAAGAGGAAATCCAGGAGCTGCAGGCTCAGATTCAGGAACAGCATGTCCAAATCGATGTGGATGTTTCCAAGCCTGACCTCACGGCTGCCCTGCGTGACGTACGTCAGCAATATGAAAGTGTGGCTGCCAAGAACCTGCAGGAGGCAGAAGAATGGTACAAATCCAAGTTTGCTGACCTCTCTGAGGCTGCCAACCGGAACAATGACGCCCTGCGCCAGGCAAAGCAGGAGTCCACTGAGTACCGGAGACAGGTGCAGTCCCTCACCTGTGAAGTGGATGCCCTTAAAGGAACCAATGAGTCCCTGGAACGCCAGATGCGTGAAATGGAAGAGAACTTTGCCGTTGAAGC

Numéro d'accès Ensembl | humain

ENSG00000026025

Numéro d'accès NCBI

NM_003380

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... VIM(7431) , VIM(7431)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
BBV
KVU
FPU
TNU
YBU

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wei Wu et al.
Virology, 497, 41-52 (2016-07-17)
Influenza A virus exploits the subcellular transport machinery during the early stages of infection. Actin filaments and microtubules facilitate the trafficking of virus-containing endosomes towards the perinuclear region; however, the role of vimentin remains to be determined. In this study
Brian Koons et al.
ACS nano, 11(12), 12037-12048 (2017-11-17)
Cell migration is studied with the traditional focus on protrusion-driven cell body displacement, while less is known on morphodynamics of individual protrusions themselves, especially in fibrous environments mimicking extracellular matrix. Here, using suspended fibers, we report integrative and multiscale abilities
Shih-Hung Chan et al.
Oncotarget, 8(25), 41364-41378 (2017-05-11)
The association between metabolic diseases and the risk of developing cancer is emerging. However, the impact of long pentraxin-3 (PTX3) on dyslipidemia-associated tumor metastasis remains unknown. In this study, we found that oleate induced PTX3 expression and secretion through the
Fu Jun Li et al.
American journal of physiology. Lung cellular and molecular physiology, 313(1), L80-L91 (2017-04-30)
Exposure to cadmium (Cd) has been associated with development of chronic obstructive lung disease (COPD). The mechanisms and signaling pathways whereby Cd causes pathological peribronchiolar fibrosis, airway remodeling, and subsequent airflow obstruction remain unclear. We aimed to evaluate whether low-dose
Alison E Patteson et al.
Small (Weinheim an der Bergstrasse, Germany), 15(50), e1903180-e1903180 (2019-11-14)
The migration of cells through constricting spaces or along fibrous tracks in tissues is important for many biological processes and depends on the mechanical properties of a cytoskeleton made up of three different filaments: F-actin, microtubules, and intermediate filaments. The
Afficher tous les articles scientifiques apparentés

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique