Direkt zum Inhalt
Merck

EMU190491

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Prkaa1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TTTTAAAGAAAGAAAAGTTGCAAGAATTTAGTGACTGCATGTGTATTTACTACTTAGCTCCTACAACTACTGTTTGGCCATATTTGCTCTCTAGATCCACACATGTATAATATACAGATATGCACATATATTCGAGTATATGTTTGCTTTTATTCTGAACCACTGAGATGTTAAGGTATATATATATATATATATATACCAGCCCTGAATACTTCAGCACTTCCTAAAAATAATAATAATGTCCTTTAGAAACCTTCTGAAACCATTATAAAATCAATAATTTCCAGATAGTGCCTGGTTTTCCAGATTAGCTGTAACTGCCCAGAATTCCATTTAAGTTACAGCCTGATTTTATTTGCAGTTCTTTAATCAGGTTAATAACACTATTTTGAAAAGATGTAGAAGAAATCCTTTCTTCAAACTGGCCAAGTTTATTTCAGGTTTTAATTCAAAATAATGAGTGGCTAAAGAAGTGTGATTTTTCTTCAATCTCTGATTTATATGCCTCTCTCC

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Ichiro Kawashima et al.
Experimental hematology, 43(7), 524-533 (2015-04-08)
Adenosine monophosphate-activated protein kinase (AMPK) is a sensor for cellular energy status. When the cellular energy level is decreased, AMPK is activated and functions to suppress energy-consuming processes, including protein synthesis. Recently, AMPK has received attention as an attractive molecular
Dong Joo Shin et al.
Journal of cellular biochemistry, 115(10), 1702-1711 (2014-05-14)
Various health effects have been attributed to the ginsenoside metabolite 20-O-β-D-glucopyranosyl-20(S)-protopanaxadiol (GPD); however, its effect on ultraviolet (UV)-induced matrix metalloproteinase (MMP)-1 expression and the mechanism underlying this effect are unknown. We examined the inhibitory effect of GPD on UV-induced MMP-1
Yan Lu et al.
Journal of cardiovascular pharmacology, 64(5), 420-430 (2014-07-01)
: Endocannabinoids are bioactive amides, esters, and ethers of long-chain polyunsaturated fatty acids. Evidence suggests that activation of the endocannabinoid pathway offers cardioprotection against myocardial ischemia, arrhythmias, and endothelial dysfunction of coronary arteries. As cardiac hypertrophy is a convergence point
Julie Sesen et al.
PloS one, 10(4), e0123721-e0123721 (2015-04-14)
High-grade gliomas, glioblastomas (GB), are refractory to conventional treatment combining surgery, chemotherapy, mainly temozolomide, and radiotherapy. This highlights an urgent need to develop novel therapies and increase the efficacy of radio/chemotherapy for these very aggressive and malignant brain tumors. Recently
Chiara Zucal et al.
BMC cancer, 15, 855-855 (2015-11-07)
Nicotinamide phosphoribosyltransferase (NAMPT), the rate-limiting enzyme in NAD(+) biosynthesis from nicotinamide, is one of the major factors regulating cancer cells metabolism and is considered a promising target for treating cancer. The prototypical NAMPT inhibitor FK866 effectively lowers NAD(+) levels in

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.