Direkt zum Inhalt
Merck

EMU076311

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rela

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
€ 197,00
50 μG
€ 349,00

€ 197,00


Versand in der Regel in 1 Woche. (Bei Bestellungen außerhalb der USA und Europas rechnen Sie bitte zusätzlich 1-2 Wochen für die Lieferung ein)


Größe auswählen

Ansicht ändern
20 μG
€ 197,00
50 μG
€ 349,00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

€ 197,00


Versand in der Regel in 1 Woche. (Bei Bestellungen außerhalb der USA und Europas rechnen Sie bitte zusätzlich 1-2 Wochen für die Lieferung ein)

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TCCATGTCTCACTCCACAGCTGAGCCCATGCTGATGGAGTACCCTGAAGCTATAACTCGCCTGGTGACAGGGTCCCAGAGGCCCCCTGACCCAGCTCCCACACCCCTGGGGACCTCGGGGCTTCCCAATGGTCTCTCCGGAGATGAAGACTTCTCCTCCATTGCGGACATGGACTTCTCTGCTCTTTTGAGTCAGATCAGCTCCTAAGGTGCTGACAGCGACCCTGCTCAGAGCACCAGGTTTCAGGGCACTGAAGCCTTCCCGAAGTGCGTACACATTCTGGGGAGTGTGCTCCAGCTGCCCCCGACTTGTTTGGGTGATCTCTCTGGGGCGGCACGTTTTACTCTTTATCTCGCTTTCGGAGGTGCTTTCGCAGGAGCATTAACCTCCTGGAGACGGAGCTGGGAGGACTCGGTGCATCCCTGTGTTGATAGCTCCTGCTTCGG

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

12 - Non Combustible Liquids

WGK

WGK 1

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

W Zhang et al.
European review for medical and pharmacological sciences, 18(9), 1361-1367 (2014-05-29)
S100A4 is a member of the S100 family of calcium-binding proteins, which possesses a wide range of biological functions, such as regulation of angiogenesis, cell survival, motility, and invasion. Here, we demonstrate for the first time a major role of
Yun Qu et al.
Cell biochemistry and function, 33(5), 320-325 (2015-07-17)
Nuclear factor-kappaB (NF-κB) is an important transcriptional factor and regulates a variety of pathophysiologic process involved in cell survival and death. This study aimed to assess the effects of NF-κB p65 subunit knockdown in suppression of nude mouse lung tumour
Martyn K White et al.
PloS one, 9(10), e110122-e110122 (2014-10-14)
The human neurotropic polyomavirus JC (JCV) causes the fatal CNS demyelinating disease progressive multifocal leukoencephalopathy (PML). JCV infection is very common and after primary infection, the virus is able to persist in an asymptomatic state. Rarely, and usually only under
Maroof Alam et al.
Oncotarget, 5(9), 2622-2634 (2014-04-29)
The capacity of breast cancer cells to form mammospheres in non-adherent serum-free culture is used as a functional characteristic of the self-renewing stem-like cell population. The present studies demonstrate that silencing expression of the MUC1-C oncoprotein inhibits growth of luminal
Junxiu Liu et al.
Gynecological endocrinology : the official journal of the International Society of Gynecological Endocrinology, 30(6), 461-465 (2014-03-22)
Vascular endothelial growth factor C (VEGF-C) promotes cervical cancer metastasis, while the detailed mechanism remains obscure. Recent evidence shows that galectin-3 (Gal-3), a glycan binding protein, interacts with the VEGF receptors and reinforces their signal transduction. In this study, we

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.